Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... were stopped by adding 3.3 m M EDTA and analyzed on an agarose gel. Thioredoxin-dependent peroxidase activity of Ch-Prx1 Peroxidase activity assays were initiated by the addition of H 2 O 2 (500 ... nucleospin extract k it (Macherey±N agel), then digested by NcoIand BamHI, and cloned i nto the pET-8c vector. Screening of a cDNA library A kgt11 cDNA library of Chlamydomo...

Ngày tải lên: 08/03/2014, 16:20

... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢. c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and ... alternative poly (A) signals [A( 1259)TAAA and A( 1430)ATTAAA] giving rise to poly (A) tails were observed by PCR-screening of the bovine mammary gland cDNA library. The N-terminal amin...

Ngày tải lên: 24/03/2014, 04:21

... Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Purification and characterization of a novel enzyme ... pyridoxal-5¢-phosphate (PLP)-dependent enzymes that catalyse elimination and replacement reactions of amino acids have been purified and characterized [6]. Keywords 1-aminocyclopropa...

Ngày tải lên: 16/03/2014, 18:20

... Interestingly, P II was the only isoform with affinity for rhamnose. As a result, P II lacked the galactose and ⁄ or N-acetyl galactosamine specificity that is a characteristic feature of the archetypal type ... galactose and galactose-containing structures, can agglutinate human and rabbit erythrocytes, and kills mice and the microcrustacean Artemia salina at very low concentra...

Ngày tải lên: 18/02/2014, 16:20

... 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense ... 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Tyr183Phe Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢ Anti-sense strand 5¢-C...

Ngày tải lên: 22/02/2014, 04:20

... 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using V NAR terminal oligonucleotide ... variant of 12F-11 incorporating mutations Cys22Ala and Cys82Val was constructed by overlapping PCR using oligonucleotid...

Ngày tải lên: 17/03/2014, 10:20

... Conus carboxylase and vertebrate vitamin K-dependent c-carboxylases argue for conservation of a vitamin K-dependent carb- oxylase across animal species and the importance of c-carboxyglutamic acid ... (Grand Island, NY, USA). RACE kits and Advantage cDNA polymerase mix were from Clontech (Palo Alto, CA, USA). AmpliTaq Gold polymerase and buffer were from Perkin–Elmer (Branch...

Ngày tải lên: 17/03/2014, 10:20

... doi:10.1046/j.1432-1033.2002.02940.x purchased from Seikagaku Corporation (Tokyo, Japan). Other chemicals were of analytical grade (Sigma–Aldrich, Amersham–Pharmacia Biotech., Wako Pure Chemical Ind. and Kanto Chemical Co.). Purification ... Hishinuma 2 , Mitsuo Mita 2 and Takashi Morita 1 Departments of 1 Biochemistry; and 2 Pharmacodynamics, Meiji Pharmaceutical University, Tokyo...

Ngày tải lên: 18/03/2014, 01:20

... Trx/TR system of the aerobic archaea. MATERIALS AND METHODS Materials The plasmid pET-3d was purchased from Novagen (Madison, WI, USA). KOD DNA polymerase and T 4 DNA polymerase were purchased from ... Identification and characterization of thioredoxin and thioredoxin reductase from Aeropyrum pernix K1 Sung-Jong Jeon and Kazuhiko Ishikawa National Institute of Advanced...

Ngày tải lên: 23/03/2014, 21:20

... and characterization of the mammalian-specific nicolin 1 gene ( NICN1 ) encoding a nuclear 24 kDa protein Bianca Backofen 1, *, Ralf Jacob 2, *, Katrin Serth 3 , Achim Gossler 3 , Hassan Y. Naim 2 and ... blot analyses with human and murine RNAs (Fig. 2). In human and mouse, specific signals were obtained at a size of approxi- mately 2.5 and 2.3 kb, respectively. The size...

Ngày tải lên: 23/03/2014, 21:20