Báo cáo khoa học: A chromatin-associated protein from pea seeds preferentially binds histones H3 and H4 pptx
... fusion protein, the cDNA encoding p16 was obtained from the psp54 (28) cDNA. The oligonucleotides used as primers were: 5¢-CCCCTCGA GATGTCTAGACAAAAAAAGAGTAG-3¢ and 5¢-CCC CTCGAGTCACACAACAGCACGAC-3¢.ThePCR product ... A chromatin-associated protein from pea seeds preferentially binds histones H3 and H4 Josefa Castillo, A ´ ngel Zu ´ n ˜ iga*, Luis Franco and M....
Ngày tải lên: 08/03/2014, 10:20
... Zhao, L. & Eghbali-Webb, M. (2001) Release of pro- and anti- angiogenic factors by human cardiac fibroblasts. Biochim. Bio- phys. Acta 1538, 273–282. 10. Balasubramanian, S., Ramakrishnan, ... [34–37] mRNA stabilization. Recent data suggests that PTB proteins may also play a role in this latter type of mRNA stabilization [62]. Factors such as HuR and hnRNPL proteins, have been implic...
Ngày tải lên: 19/02/2014, 12:20
... fixed and double-stained with polyclonal antip35 (C-19) and anti-AT8 Ig (a, c, and e) and with polyclonal antip35 (N-20) and anti-AT8 Ig (b, d, and f). a and b expressed transfected p25 and p35, ... the eight amino acid Xpress epitope: Asp-Leu-Tyr-Asp-Asp-Asp-Asp-Lys; Invitrogen, Carlsbad, CA, USA) and anti-T7 Tag monoclonal antibody (Novagen, San Diego, CA, USA). A pcDNA...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: The Rieske protein from Paracoccus denitrificans is inserted into the cytoplasmic membrane by the twin-arginine translocase doc
... 5¢-GATCACGGCGCC ACGAAGAGGGACTTCCTCTAC-3¢; R16K, 5¢-CACGG CGCCACCCGGAAGGACTTCCTCTAC-3¢; R15K ⁄ R16K, 5¢-GATCACGGCGCCACCAAGAAGGACTTCCTCTAC TACG-3¢; Y20K, 5¢-GGAGGGACTTCCTGAAGTAC GCGACGGCCGGTG-3¢; C152S, 5¢-GGCGGCTGGTTC AGCCCGTGCCATGG-3¢. ... spectroscopy All enzymatic measurements were performed at ambient temperature on a Hitachi U-3000 spectrophotometer (Hita- chi, Tokyo, Japan). Malate deh...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGC TACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTG...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx
... formation and acti- vation of activity, and concluded that glutaminase is only active as a dimer, or a larger aggregate. The results shown here suggest that the trehalase is also activated and aggregated ... other trehalases that have been isolated and purified from various other organisms, and at least partially charac- terized. Most of these enzymes are from fungi or yeast,...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Antioxidant Dps protein from the thermophilic cyanobacterium Thermosynechococcus elongatus An intrinsically stable cage-like structure endowed with enhanced stability potx
... gene was amplified by PCR from the genome of T. elongatus BP1 (kindly provided by T. Kaneko, Kazusa DNA Research Institute), using primers Dps-Te1 (5¢-CA AAGGAGACT CATATGAGTGCAACAACTAC-3¢) and Dps-Te2 ... 10761 E-mail: andrea.ilari@uniroma1.it Database The atomic coordinates and structure fac- tors have been deposited in the Protein Data Bank, Research Laboratory for Struc- tural Bioin...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx
... separates the termination and initiation codons for panD and aq477, they appear to be organized as an operon. panD encodes an aspartate decarboxylase which cata- lyses the decarboxilation of aspartate ... the catalytic domain of thiosulfate cyanide sulfurtransferase (TST) which is distributed among bac- teria, archaea and eukaryotes. Aq-477 catalyses sulfur transfer from thiosulfate,...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Putative prion protein from Fugu (Takifugu rubripes) ppt
... Japanese seabass (Lateolabrax japonicus) and Japanese flounder (Para- lichthys olivaceus) [18] have been described and com- pared (for a sequence alignment, see Rivera-Milla et al. [8]). An early ... Liao M, Zhang Z, Yang G, Sun X, Zou G, Wei Q & Wang D (2005) Cloning and characterization of prion protein coding genes of Japanese seabass (Lateolabrax japonicus) and Japanese flou...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx
... (non-spontaneous voicing) and N (nasality), and the resonance elements A (low), I (palatal), U (labial) and R (coronal). These elements are phonologically active - they can spread to neighbouring ... traditional ASR applications (e.g. dictation, database access), but also embraces multilingual speech input, medical (speech therapy) and teaching (computer-assisted language le...
Ngày tải lên: 31/03/2014, 04:20