Báo cáo khoa học: A chromatin-associated protein from pea seeds preferentially binds histones H3 and H4 pptx
Báo cáo khoa học: A chromatin-associated protein from pea seeds preferentially binds histones H3 and H4 pptx
... fusion protein, the cDNA
encoding p16 was obtained from the psp54 (28) cDNA.
The oligonucleotides used as primers were: 5¢-CCCCTCGA
GATGTCTAGACAAAAAAAGAGTAG-3¢ and 5¢-CCC
CTCGAGTCACACAACAGCACGAC-3¢.ThePCR
product ... A chromatin-associated protein from pea seeds preferentially binds
histones H3 and H4
Josefa Castillo, A
´
ngel Zu
´
n
˜
iga*, Luis Franco and M....
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx
... Zhao, L. & Eghbali-Webb, M. (2001) Release of pro- and anti-
angiogenic factors by human cardiac fibroblasts. Biochim. Bio-
phys. Acta 1538, 273–282.
10. Balasubramanian, S., Ramakrishnan, ... [34–37] mRNA
stabilization. Recent data suggests that PTB proteins may
also play a role in this latter type of mRNA stabilization
[62]. Factors such as HuR and hnRNPL proteins, have been
implic...
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf
... fixed and double-stained with polyclonal antip35 (C-19) and
anti-AT8 Ig (a, c, and e) and with polyclonal antip35 (N-20) and anti-AT8 Ig (b, d, and f). a and b expressed transfected p25 and p35, ... the eight amino acid Xpress
epitope: Asp-Leu-Tyr-Asp-Asp-Asp-Asp-Lys; Invitrogen,
Carlsbad, CA, USA) and anti-T7 Tag monoclonal antibody
(Novagen, San Diego, CA, USA). A pcDNA...
Báo cáo khoa học: The Rieske protein from Paracoccus denitrificans is inserted into the cytoplasmic membrane by the twin-arginine translocase doc
... 5¢-GATCACGGCGCC
ACGAAGAGGGACTTCCTCTAC-3¢; R16K, 5¢-CACGG
CGCCACCCGGAAGGACTTCCTCTAC-3¢; R15K ⁄ R16K,
5¢-GATCACGGCGCCACCAAGAAGGACTTCCTCTAC
TACG-3¢; Y20K, 5¢-GGAGGGACTTCCTGAAGTAC
GCGACGGCCGGTG-3¢; C152S, 5¢-GGCGGCTGGTTC
AGCCCGTGCCATGG-3¢. ... spectroscopy
All enzymatic measurements were performed at ambient
temperature on a Hitachi U-3000 spectrophotometer (Hita-
chi, Tokyo, Japan).
Malate deh...
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... (GenBank accession number X52869) was
amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA)
by PCR using sense primer 5¢-ATCAAAACAACCAAAA
TGGCCAAGTTGACCAGTGC-3¢ and antisense primer
5¢-GAAT
GCGGCCGCTCAGTCCTGCTC ... fragment of the fcp 5¢-UTR was amplified by PCR
from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT
CTTTGC
TACGTACGAACG-3¢ and the antisense primer
5¢-GCTCTAGAGATATCTAGTCTTTG...
Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx
... formation and acti-
vation of activity, and concluded that glutaminase is
only active as a dimer, or a larger aggregate. The
results shown here suggest that the trehalase is also
activated and aggregated ... other
trehalases that have been isolated and purified from
various other organisms, and at least partially charac-
terized. Most of these enzymes are from fungi or yeast,...
Báo cáo khoa học: Antioxidant Dps protein from the thermophilic cyanobacterium Thermosynechococcus elongatus An intrinsically stable cage-like structure endowed with enhanced stability potx
... gene was amplified by PCR from the genome of
T. elongatus BP1 (kindly provided by T. Kaneko, Kazusa
DNA Research Institute), using primers Dps-Te1 (5¢-CA
AAGGAGACT
CATATGAGTGCAACAACTAC-3¢) and
Dps-Te2 ... 10761
E-mail: andrea.ilari@uniroma1.it
Database
The atomic coordinates and structure fac-
tors have been deposited in the Protein
Data Bank, Research Laboratory for Struc-
tural Bioin...
Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx
... separates the
termination and initiation codons for panD and
aq477, they appear to be organized as an operon.
panD encodes an aspartate decarboxylase which cata-
lyses the decarboxilation of aspartate ... the catalytic domain of thiosulfate cyanide
sulfurtransferase (TST) which is distributed among bac-
teria, archaea and eukaryotes. Aq-477 catalyses sulfur
transfer from thiosulfate,...
Báo cáo khoa học: Putative prion protein from Fugu (Takifugu rubripes) ppt
... Japanese seabass
(Lateolabrax japonicus) and Japanese flounder (Para-
lichthys olivaceus) [18] have been described and com-
pared (for a sequence alignment, see Rivera-Milla
et al. [8]). An early ... Liao M, Zhang Z, Yang G, Sun X, Zou G, Wei Q &
Wang D (2005) Cloning and characterization of prion
protein coding genes of Japanese seabass (Lateolabrax
japonicus) and Japanese flou...
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx
... (non-spontaneous voicing) and N
(nasality), and the resonance elements A (low), I
(palatal), U (labial) and R (coronal). These elements
are phonologically active - they can spread to
neighbouring ... traditional ASR
applications (e.g. dictation, database access), but also
embraces multilingual speech input, medical (speech
therapy) and teaching (computer-assisted language
le...
Từ khóa: