Báo cáo khoa học: NblA from Anabaena sp PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot
Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot
... gene from Anabaena sp. PCC 7120 and purified the protein without tags. We show that NblA from Anabaena sp. PCC 7120 is a mostly a- helical protein. The results from the thermally induced folding-unfolding experiments ... extracts (NblA1 and NblA2 from Synechocystis sp. PCC 6803) or purified in recombinant form from E. coli (NblA1 and NblA2 from Syne...
Ngày tải lên: 08/03/2014, 10:20
Tài liệu Báo cáo khoa học: Acetylcholinesterase from the invertebrate Ciona intestinalis is capable of assembling into asymmetric forms when co-expressed with vertebrate collagenic tail peptide doc
... 2157–2167. 8 Satou Y, Yamada L, Mochizuki Y, Takatori N, Kawashima T, Sasaki A, Hamaguchi M, Awazu S, Yagi K, Sasakura Y et al. (2002) A cDNA resource from the basal chordate Ciona intestinalis. Genesis ... preserved. It is highly unlikely that this protein is an active AChE because it is missing a member of the catalytic triad and the main aromatic residue for binding of subst...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Proteomics of Synechocystis sp. PCC 6803 Identification of novel integral plasma membrane proteins docx
... 3994–4003. 53 Kaneko T, Nakamura Y, Sasamoto S, Watanabe A, Kohara M, Matsumoto M, Shimpo S, Yamada M & Tabata S (2003) Structural analysis of four large plas- mids harboring in a unicellular cyanobacterium, ... Synechocystis sp. PCC 6803 Identification of novel integral plasma membrane proteins Tatiana Pisareva 1 , Maria Shumskaya 1 , Gianluca Maddalo 2 , Leopold Ilag 2 and Birgi...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo khóa học: Volkensin from Adenia volkensii Harms (kilyambiti plant), a type 2 ribosome-inactivating protein pptx
... alga [1] (Laminaria japonica), a fungus [2] (Volvariella volvacea) and bacteria [3] (Shiga and Shiga- like toxins). They are divided into three main groups. Type 1 RIPs are single-chain proteins ... N-b-glycosidase activity. Type 2 RIPs are larger proteins consisting of two distinct chains: an A- chain (with the same enzymatic activity as type 1 RIPs) that is linked by a disulfide bridg...
Ngày tải lên: 30/03/2014, 13:20
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... essential part in cell signaling during axonal development. Receptor protein tyrosine phosphatase-r has been implicated in the growth, guidance and repair of retinal axons. This phosphatase has also ... ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2). A protein band of approximately 95 kDa is present exclusively in the FN3...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢-to3¢) Size (bp) MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178 MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246 BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173 CA9 TTTGAATGGGCGAGT...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Detergent-resistant membrane fractions contribute to the total 1 H NMR-visible lipid signal in cell potx
... enriched in saturated fatty acids, relative to the cell homogenate and the total membrane fraction, except for a very small increase in myristic acid (14:0). Rather there was a small increase in palmitoleic ... m M p-aminobenzoic acid (PABA) was added to all fractions isolated from the cells. Integrals of phase and baseline corrected NMR spectra were determined using XWINNMR 2.6 (...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: What determines the degree of compactness of a calcium-binding protein? pdf
... the calcium- binding protein, showing that this form is mainly governed by short-range interactions. Abbreviations CaBP, calcium-binding protein; LAH, linker average hydrophilicity; PDB, Protein ... classes also have different structural features: calcium-buffering and calcium-transporting proteins, such as parvalbu- min [7] or the Nereis diversicolor sarcoplasmic calcium- binding prot...
Ngày tải lên: 30/03/2014, 02:20
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx
... Yamashita A, Nagatsuka T, Watanabe M, Kondo H, Sugiura T & Waku K (1997) Inhibition of UDP-glucur- onosyltransferase activity by fatty acyl-CoA. Kinetic studies and structure-activity relationship. ... that aminopyrine, metyrapone and other xenobiotics cause an almost instantaneous increase in the conversion of UDP-glucuronate to glucuronate in isolated rat hepatocytes [4]. The preci...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... proliferation and invasion. Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48]. Thus, in most cases, choriocarcinoma ... C-terminal cytosolic domain of SR-BI which is a critical domain involved in selective CE-uptake [29,53] is lacking in SR-BII and the lack of SR-BII protein in all three...
Ngày tải lên: 20/02/2014, 23:20