Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

... Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor Patrizia Agretti 1 , ... described as a cause of congenital hypothyroidism. The effects of combining activating and inactivating mutations within a single receptor was stu...

Ngày tải lên: 08/03/2014, 08:20

... strand exchange assay were synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and ... the sta- tus of physical union and separation of complementary strands during renaturation and strand exchange, respectively, and...

Ngày tải lên: 19/02/2014, 07:20

... unique antiviral activity of the DZA analogs. As AdoHcy hydrolase inhibitors, DZA and DZAri have been shown to decrease the AdoMet/AdoHcy ratio and inhibit methylation of DNA, RNA, protein, lipid, and ... West Palm Beach, Florida, USA; 6 Bioinformatics Laboratory, International Institute of Molecular and Cell Biology, Warsaw, Poland Eight adenosine analogs, 3-deaza-adenosine (...

Ngày tải lên: 08/03/2014, 08:20

... serine ⁄ threonine kinase activity [13,15,37] and binding to actin [12], YpkA has been shown to interact with small GTPases and inhibit nucleotide exchange in Rac1 and RhoA, mimicking the guanidine ... immunoprecipitation of OTUB1. As a control, lysate was incubated with agarose without the antibody. Immunoprecipitated material was analysed by SDS ⁄ PAGE and silver staining,...

Ngày tải lên: 16/02/2014, 15:20

... column and RP-HPLC, and analyzed by SDS ⁄ PAGE and mass spectrometry (Fig. 5). The molecular masses of the recombinant full-length histone H1.2 and its N- and C-terminal fragments determined by mass ... spectrometry analysis of the recombinant full-length his- tone H1.2 and its N- and C-terminal frag- ments. (A) The recombinant full-length histone H1.2 and its N- and C-t...

Ngày tải lên: 16/03/2014, 13:20

... Zeta, Phi, Tau and O mega [3,4,9]. Whereas Zeta, Theta and Omega classes of GSTs are found in plants and animals, the large Phi and Tau classes a re unique to plants [9]. In maize ( Zea m ays L), 42 ... the absence of any structural perturbation caused by the mutation. Amino- acid analysis of the SDTG-modified Phe51Ala mutant and determination of its total amino and...

Ngày tải lên: 16/03/2014, 16:20

... Shoolingin-Jordan PM, Al-Dbass A, McNeill LA, Sarwar M & Butler D (2003) Human porphobilinogen deaminase mutations in the investigation of the mecha- nism of dipyrromethane cofactor assembly and ... as the standard and 12.5% TCA as a blank. The exact concentration was determined at room temperature by mea- suring A 405 and calculated as A 405 ⁄ e (e – 505 · 10 3 LÆcm )1...

Ngày tải lên: 23/03/2014, 04:21

... ⁄ PAGE gels. HA protein-containing bands were visualized by the use of an anti-HA serum (Covance), and myc protein-containing bands by an anti-Myc serum (Sigma-Aldrich). Chemical cross-linking ... was used with the mutagenic forward primer 5¢-GCTCTATTCCTGTCTATCGCTAGCT CTGTTCTGGAAAGTTTCATAGAAG-3¢ and the muta- genic reverse primer 5¢-CTTCTATGAAACTTTCCAGA ACAG AGCTAGCGA TAGAACCCA GGAA...

Ngày tải lên: 29/03/2014, 21:20

... Chemistry, Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Sugitani, Toyama, Japan Fibroblasts play a critical role in chronic in ammation and wound healing. In this ... SDS/PAGE analyses of a fibroblast growth-stimulating factor (FGSF) and recombinant S10 0A9 . FGSF purified by rechromatography of peak 1 indicated in Fig. 1, recombinant...

Ngày tải lên: 30/03/2014, 13:20

... 13705; E-mail: ssoubeyrand@ohri.ca Abbreviations: ATM, ataxia telangiectasia mutated gene product; ATR, ataxia telangectasia and RAD-3-related kinase; dsDNA, double-stranded DNA; DNA-PK, DNA-dependent ... roduct and t he ataxia t elangectasia and RAD-3-related kinase promote phosphorylation o f human p53 at Ser15 and Ser20, and are required for the activation of p53 f ollowing DNA...

Ngày tải lên: 30/03/2014, 15:20