Báo cáo khoa học: Proper targeting and activity of a nonfunc

Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

... Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor Patrizia Agretti 1 , ... described as a cause of congenital hypothyroidism. The eﬀects of combining activating and inactivating mutations within a single receptor was stu...

Ngày tải lên : 08/03/2014, 08:20

9
499
0

Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by ﬂuorescence resonance energy transfer and the role of ATP hydrolysis pptx

... strand exchange assay were synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and ... the sta- tus of physical union and separation of complementary strands during renaturation and strand exchange, respectively, and...

Ngày tải lên : 19/02/2014, 07:20

10
568
0

Báo cáo khoa học: Anti-HIV-1 activity of 3-deaza-adenosine analogs Inhibition of S-adenosylhomocysteine hydrolase and nucleotide congeners pot

... unique antiviral activity of the DZA analogs. As AdoHcy hydrolase inhibitors, DZA and DZAri have been shown to decrease the AdoMet/AdoHcy ratio and inhibit methylation of DNA, RNA, protein, lipid, and ... West Palm Beach, Florida, USA; 6 Bioinformatics Laboratory, International Institute of Molecular and Cell Biology, Warsaw, Poland Eight adenosine analogs, 3-deaza-adenosine (...

Ngày tải lên : 08/03/2014, 08:20

11
303
0

Tài liệu Báo cáo khoa học: Post-translational modiﬁcation of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... serine ⁄ threonine kinase activity [13,15,37] and binding to actin [12], YpkA has been shown to interact with small GTPases and inhibit nucleotide exchange in Rac1 and RhoA, mimicking the guanidine ... immunoprecipitation of OTUB1. As a control, lysate was incubated with agarose without the antibody. Immunoprecipitated material was analysed by SDS ⁄ PAGE and silver staining,...

Ngày tải lên : 16/02/2014, 15:20

16
654
0

Báo cáo khoa học: The potent inhibitory activity of histone H1.2 C-terminal fragments on furin doc

... column and RP-HPLC, and analyzed by SDS ⁄ PAGE and mass spectrometry (Fig. 5). The molecular masses of the recombinant full-length histone H1.2 and its N- and C-terminal fragments determined by mass ... spectrometry analysis of the recombinant full-length histone H1.2 and its N- and C-terminal fragments. (A) The recombinant full-length histone H1.2 and its N- and C-t...

Ngày tải lên : 16/03/2014, 13:20

11
286
0

Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new afﬁnity label for probing the structure and function of glutathione transferases potx

... Zeta, Phi, Tau and O mega [3,4,9]. Whereas Zeta, Theta and Omega classes of GSTs are found in plants and animals, the large Phi and Tau classes a re unique to plants [9]. In maize ( Zea m ays L), 42 ... the absence of any structural perturbation caused by the mutation. Amino- acid analysis of the SDTG-modiﬁed Phe51Ala mutant and determination of its total amino and...

Ngày tải lên : 16/03/2014, 16:20

9
556
0

Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

... Shoolingin-Jordan PM, Al-Dbass A, McNeill LA, Sarwar M & Butler D (2003) Human porphobilinogen deaminase mutations in the investigation of the mecha- nism of dipyrromethane cofactor assembly and ... as the standard and 12.5% TCA as a blank. The exact concentration was determined at room temperature by mea- suring A 405 and calculated as A 405 ⁄ e (e – 505 · 10 3 LÆcm )1...

Ngày tải lên : 23/03/2014, 04:21

10
587
0

Báo cáo khoa học: Lpe10p modulates the activity of the Mrs2p-based yeast mitochondrial Mg2+channel pot

... ⁄ PAGE gels. HA protein-containing bands were visualized by the use of an anti-HA serum (Covance), and myc protein-containing bands by an anti-Myc serum (Sigma-Aldrich). Chemical cross-linking ... was used with the mutagenic forward primer 5¢-GCTCTATTCCTGTCTATCGCTAGCT CTGTTCTGGAAAGTTTCATAGAAG-3¢ and the mutagenic reverse primer 5¢-CTTCTATGAAACTTTCCAGA ACAG AGCTAGCGA TAGAACCCA GGAA...

Ngày tải lên : 29/03/2014, 21:20

12
237
0

Báo cáo khoa học: Fibroblast growth-stimulating activity of S100A9 (MRP-14) ppt

... Chemistry, Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Sugitani, Toyama, Japan Fibroblasts play a critical role in chronic in ammation and wound healing. In this ... SDS/PAGE analyses of a ﬁbroblast growth-stimulating factor (FGSF) and recombinant S10 0A9 . FGSF puriﬁed by rechromatography of peak 1 indicated in Fig. 1, recombinant...

Ngày tải lên : 30/03/2014, 13:20

7
277
0

Báo cáo khoa học: Structured DNA promotes phosphorylation of p53 by DNA-dependent protein kinase at serine 9 and threonine 18 doc

... 13705; E-mail: ssoubeyrand@ohri.ca Abbreviations: ATM, ataxia telangiectasia mutated gene product; ATR, ataxia telangectasia and RAD-3-related kinase; dsDNA, double-stranded DNA; DNA-PK, DNA-dependent ... roduct and t he ataxia t elangectasia and RAD-3-related kinase promote phosphorylation o f human p53 at Ser15 and Ser20, and are required for the activation of p53 f ollowing DNA...

Ngày tải lên : 30/03/2014, 15:20

9
321
0