Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L ) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... new S -adenosyl- L - methionine:flavonoid 4¢- O -methyltransferase from carnation ( Dianthus caryophyllus L. ) Paolo Curir 1 , Virginia Lanzotti 2 , Marcello Dolci 3 , Paola Dolci 3 , Carlo Pasini 1 and Gordon Tollin 4 1 Istituto ... method of Baayen and Elgersma [13], with a 500-lLdropofFod conidial suspension at a concentration of 9 · 10 6 conidiaÆmL )1 ;20 add...

Ngày tải lên: 08/03/2014, 08:20

10 624 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... surface of neoplastic cells [11]. Human malignant melanoma contains 9-O-acetyl-NeuAc [8,12] and in human colon carcinoma tissues N-glycolylneuraminic acid [10,13] as well as a2 ,6-linked sialic acids ... glycosidic linkages [5] on cell-surface glycocon- jugates, namely glycoproteins and glycolipids, or in bacter- ial polysaccharides. Sialic acids are a family of sugars, N-acetylneu...

Ngày tải lên: 21/02/2014, 00:20

8 617 0
Báo cáo khoa học: Purification and properties of the glutathione S-transferases from the anoxia-tolerant turtle, Trachemys scripta elegans pdf

Báo cáo khoa học: Purification and properties of the glutathione S-transferases from the anoxia-tolerant turtle, Trachemys scripta elegans pdf

... SS, Saxena M, Ahmad H, Awasthi S, Haque AK & Awasthi YC (199 2) Glutathione S-transferases of human lung: characterization and evaluation of the pro- tective role of the a- class isozymes against ... Doi AM, Pham RT, Hughes EM, Barber DS & Galla- gher EP (200 4) Molecular cloning and characterization of a glutathione S-transferase from largemouth bass (Micropter...

Ngày tải lên: 23/03/2014, 15:20

13 433 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... proteins. The polypeptide with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B 1). Table 1. N-Terminal sequences of the polypeptides of the purified ... experimentally (apparent molecular mass, cofactor content). Gene AF502 AF501 AF499 AF503 AF500 Apparent/calculated molecular mass 53/64.4 kDa 34/38 kDa 31/30.5 kDa 16/16.7 kDa – /...

Ngày tải lên: 21/02/2014, 03:20

10 564 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

... (200 0) Purification and characteri- zation of glutathione S-transferases from the German cockroach, Blattella germanica (L. ). Pestic Biochem Physiol 67, 36–45. 8 Arruda LK, Vailes LD, Platts-Mills ... Characterization and comparison of commerically available German and American cockroach allergen extracts. Clin Exp Allergy 32, 721–727. 22 Tang AH & Tu C-PD (199 4)...

Ngày tải lên: 23/03/2014, 09:21

11 426 0
Báo cáo khoa học: Purification and characterization of novel salt-active acharan sulfate lyase from Bacteroides stercoris HJ-15 ppt

Báo cáo khoa học: Purification and characterization of novel salt-active acharan sulfate lyase from Bacteroides stercoris HJ-15 ppt

... salt-active acharan sulfate lyase The purified salt-active acharan sulfate lyase degraded heparin and heparan sulfate as well as acharan sulfate (Table 5). The salt-active acharan sulfate lyase was the ... heparin lyase III cleaved heparin as well as heparan sulfate, but did not cleave acharan sulfate. The Bacteroidal acharan sulfate lyase, which potently cleaved acharan sulfate as well as...

Ngày tải lên: 23/03/2014, 21:20

6 401 0
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon Kentaro Takahara, Kinya Akashi and Akiho Yokota Graduate School of Biological Sciences, Nara Institute ... (5¢-TCCT- CCATCAATCTGCTTCCATGGACCATC-3 ), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC- 3) and CLGAT3b (5¢-AAGGGAGAGAAACCTGACCTTGCACTTG-3 ). The 5¢-RACE was performed using M...

Ngày tải lên: 20/02/2014, 03:20

12 649 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

... GTGATCCCGATTATTCTGTGTGTT Cloning of sipW W9 GGCGATGTCATCACTTTTACACAA Cloning of sipW W10 AACACACAGAATAATCGGGATCAC Cloning of sipW W11 GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWh W12 CGAGATCTTGTGGACATGGTCCCGTTTC ... isopropyl thio-b- D -galactoside. De®nitions:SipS(ba), SipS(bj), SipT(ba), SipV(ba) and SipW(ba)are the products of the sipS(ba), sipS(bj), sipT(ba), sipV(ba) ,...

Ngày tải lên: 21/02/2014, 03:20

12 596 0
Báo cáo khoa học: Purification and characterization of zebrafish hatching enzyme – an evolutionary aspect of the mechanism of egg envelope digestion pot

Báo cáo khoa học: Purification and characterization of zebrafish hatching enzyme – an evolutionary aspect of the mechanism of egg envelope digestion pot

... by Elopomorpha, and then branched paraphyletically to Otocephala and Euteleostei [11–14]. The cDNA cloning analysis using Japanese eel Anguilla japonica belonging to Elopomorpha revealed that several hatch- ing ... by Amicon Ultra 15 Ultracel-10K (Millipore Co., Billerica, MA, USA). Approximately 500 lL of the concentrated hatching liquid was applied to a Superdex 75 10 ⁄ 300 GL colum...

Ngày tải lên: 07/03/2014, 04:20

13 581 0
Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

... (200 5) Molecular phylo- geny and evolution of Caricaceae based on rDNA inter- nal transcribed spacer (ITS) and chloroplast sequence data. Mol Phyl Evol 37, 442–459. 3 Badillo VM (200 0) Carica L. ... while crude babaco (Vasconcellea · heilbornii ‘babaco ) latex revealed an equivalent or slightly higher proteolytic and lipolytic activity than that of papaya [22]. In a la...

Ngày tải lên: 07/03/2014, 11:20

12 525 0
w