Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis Elisa Borra ´ s, Rosa Zaragoza ´ , Marı ´ a Morante, ... vitamin A in controlling the expression of p53 and related genes that are essential for maintaining the integrity of tissues. Materials and...
Ngày tải lên: 08/03/2014, 08:20
... Surolia N, RamachandraRao SR & Surolia A (2002) Paradigm shifts in malaria parasite biochemistry and anti-malarial chemotherapy. Bioessays 24, 192–196. 5 Ramya TNC, Surolia N & Surolia A ... profile of apo-ACP and holo-ACP on a MonoQ HR 5 ⁄ 5 anion exchange column. Peak 1: apo-ACP. Peak 2: holo-ACP. (G) Separation of apo-ACP and holo-ACP; 12% native PAGE showing the s...
Ngày tải lên: 16/03/2014, 10:20
... Sugimoto 1 1 Fermentation & Biotechnology Laboratories and 2 Central Research Laboratories, Ajinomoto Co., Inc., Kawasaki-ku, Kawasaki, Kanagawa, Japan Corynebacterium ammoniagenes is an overproducer of xanthosine-5¢-monophosphate ... sugar phos- phate and intracellular inorganic phosphate (P in i ) signals at approximately )5–0 p.p.m. were not distinct from the accumulated XMP a...
Ngày tải lên: 23/03/2014, 17:22
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf
... Asanuma M, Sogawa N, Miyazaki I, Nakanishi T, Furuta H & Ogawa N (2001) Localiza- tion, regulation, and function of metallothionein-III ⁄ growth inhibitory factor in the brain. Acta Med Okayama ... considerable insight into the potential role of GIF in neurofibrillary changes associated with AD. Potential role of metal-binding/exchange properties of GIF in AD One of the p...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: "Phrase-Based Backoff Models for Machine Translation of Highly Inflected Languages" docx
... the domain is fixed, the training and test data match, and a large amount of training data is available. Nevertheless, standard SMT models tend to perform much bet- ter on languages that are morphologically ... are also typically fre- quent words and have an appropriate translation in the training data. 1 http://snowball.tartarus.org 5 Data Our data consists of the Europarl train...
Ngày tải lên: 22/02/2014, 02:20
Tài liệu Báo cáo khoa học: "An ISU Dialogue System Exhibiting Reinforcement Learning of Dialogue Policies: Generic Slot-filling in the TALK In-car System" pot
... (a java OAA agent), Database agent (java OAA wrappe r to MySQL). 5.1 Dialogue Policy Learner Age nt This agent acts as an interface between the DIPPER dialogue manager and the sy stem simulation ... which: contains an interface to a dialogue strategy learner module, covers a realistic domain of useful in- car” con- versation and a wide range of dialogue phenom- ena (e.g . confir...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: Human telomeric G-quadruplex: The current status of telomeric G-quadruplexes as therapeutic targets in human cancer pdf
... follows DNA double-strand breaks. This involves in particular ATM, p16 INK 4a kinase and p53 pathways [32–35] which can be visualized by the appearance of charac- teristic DNA damage foci using an antibody ... cis-platinum, taxol and camptothecin deriva- Table 1. Selected in vivo data on quadruplex-binding ligands. Tumour responses have been estimated from survival curves and...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... forward, GTTTGAATTGGCCAGAGGAA reverse, TCTGTTGGAAAATCCCGTTC Cxcl10 forward, CCCACGTGTTGAGATCATTG reverse, GAGGAACAGCAGAGAGCCTC Cxcl10 pre-mRNA forward, AGCAGAGGAAAATGCACCAG reverse, CACCTGGGTAAAGGGGAGTGA Dusp16 ... AGGCCACTGACTAGGCTGAA Egr1 pre-mRNA forward, GAGCAGGTCCAGGAACATTG reverse, GGGATAACTCGTCTCCACCA Ndrg1 forward, ACCTGCTACAACCCCCTCTT reverse, TGCCAATGACACTCTTGAGC Idi1 forward, GGGCT...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). The result- ing PCR fragment was cloned into ... (5¢-ACGC GGATCCAG TCATAAACAGCGGTTGC-3¢, Bam HI site un derlined), 87SufI-BamHI-rv (5 ¢-ACGC GGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5¢-ACTG ATCGATCTAG...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... and overexpressing strains were characterized in detail in exponential and sta- tionary phase of bioreactor cultures containing minimal media, with glu- cose as the carbon source and ammonium or nitrate as the ... G6PDH, 6PGDH and TKT. Wild-type and engineered strains were characterized in detail in bioreactor cultures using multivariate data analysis showing that overprod...
Ngày tải lên: 07/03/2014, 17:20