Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx

Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx

Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx

... label of the parent and of ancestors with a different category, as in the case of VP/S-NOM in the example. 2.1 Task representation and evaluation method To formulate the task as a machine-learnable ... Shallow parsing on the basis of words only: A case study Antal van den Bosch and Sabine Buchholz ILK / Computational Linguistics and AI Tilburg University...

Ngày tải lên: 08/03/2014, 07:20

8 658 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

... whereas that for melibiose and a- Me-Gal, as anomers of lactose and b-Me-Gal, was in the intermediate exchange regime. Thus, the configuration at the hemiacetal carbon of galactose may affect the ... Cross-peaks are labeled based on an analysis of through-bond connectivities. The side chains of NH 2 resonances of aspara- gines and glutamines are connected by horizontal l...

Ngày tải lên: 23/03/2014, 04:21

11 458 0
Báo cáo khoa học: "Corpus Effects on the Evaluation of Automated Transliteration Systems" docx

Báo cáo khoa học: "Corpus Effects on the Evaluation of Automated Transliteration Systems" docx

... held at least a Bachelors de- gree. Table 1 summarizes the information about the transliterators and their perception of the given task. Participants were asked to scale the difficulty of the transliteration ... Persian translit- eration systems on a variety of controlled corpora using evaluation metrics that appear in previous transliteration studies. Varying the evalu...

Ngày tải lên: 23/03/2014, 18:20

8 433 0
Báo cáo khoa học: Preliminary Report on the Insertion of English Articles in RussianEnglish MT Output"" pdf

Báo cáo khoa học: Preliminary Report on the Insertion of English Articles in RussianEnglish MT Output"" pdf

... Corporation Research on a non-statistical scheme for the insertion of English articles in machine-translated Russian is described. Ideal article insertion as a goal is challenged as unreasonable. ... considerations, or use a combined syntactico- statistical method; the aim of all such routines is the selection of one and only one of the four articles (a, an, the...

Ngày tải lên: 30/03/2014, 17:20

3 423 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... 2 in the mito- chondrial membranes of all of the deletion mutants suggest that these can be assembled as a subcomplex in the mito- chondrial membrane, independent of the presence of any other ... Electro- phoretic analysis of DNA on agarose gels, restriction endonuclease analysis, ligation of DNA fragments, Table 1. Yeast strains used in this study. Strain Genotype Ref...

Ngày tải lên: 19/02/2014, 12:20

10 518 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... Ca 2+ -dependent manner almost as effectively as intact Akazara scallop troponin. Therefore, Akazara scallop troponin regulates the contraction through the activating mechanisms that involve the region spanning ... in the absence of divalent cation. Therefore, this interaction potentially participates in both the Ca 2+ -dependent activation of the contraction and the mainten...

Ngày tải lên: 20/02/2014, 01:20

12 515 0
Báo cáo khoa học: "An experiment on the upper bound of interjudge agreement: the case of tagging" docx

Báo cáo khoa học: "An experiment on the upper bound of interjudge agreement: the case of tagging" docx

... descriptive grammar by Quirk et al. (1985), also that work was made available to them, as well as a number of modern English dictionaries. The training was based on the disambiguation of ten smallish ... patents ('Pat'); one contained excerpts from the law of Cali- fornia; one was a medical text ('Med'). None of them had been used in the developm...

Ngày tải lên: 08/03/2014, 21:20

5 353 0
Báo cáo khoa học: "Incremental Parsing with the Perceptron Algorithm" potx

Báo cáo khoa học: "Incremental Parsing with the Perceptron Algorithm" potx

... the parser will depend on the definition of partial analyses, of ADV and FILTER, and of the representation Φ. The next section describes our instantiation of these choices. 3 A full description ... incorporated into a partial analysis for the previous words. For any partial analysis there will be a set of potential attachment sites: in the example, the attachme...

Ngày tải lên: 23/03/2014, 19:20

8 418 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 ... in about 252 1A BC 5′ 3′ 5′ 3′ 5′ 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUU...

Ngày tải lên: 18/02/2014, 04:20

9 541 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: pectenotoxins, unusual macrolides that disrupt actin pptx

Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: pectenotoxins, unusual macrolides that disrupt actin pptx

... chemotherapy agents and actin cytoskeleton dynamics with potential clinical applications. Abbreviations F-actin, filamentous actin; G-actin, globular actin; OA, okadaic acid; PTX, pectenotoxin; SA, ... nucle- ation. On the basis of models of the actin filament, PTX binding would disrupt key lateral contacts between the PTX-bound actin monomer and the lower lateral actin monomer...

Ngày tải lên: 18/02/2014, 14:20

7 507 0
Từ khóa:
w