Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf
... Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning Hideki Isozaki NTT Communication Science Laboratories 2-4 Hikaridai, Seika-cho, Souraku-gun, ... categories such as person, organization, location, and date. NE recognition plays an es- sential role in information extraction systems and question answering sys- tems. It i...
Ngày tải lên: 08/03/2014, 05:20
... 1 and 2. Each row in Table 1 contains a feature type, feature values, and an experimental result that will be explained later. Each feature consists of a type and a value. The features are ... was about 3% higher than that of Shirai's model, although we used a much smaller set of training data. We believe that it is because his approach is based on a hand-made...
Ngày tải lên: 08/03/2014, 21:20
... GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG. The annealing s ite f or the upstream primer corresponds to 12 amino acids before the protease sequence. ... methods Expression of HIV-1 protease The expression and purification of HIV-1 protease w as adapted from Andersson et al. [21]. The protease gene was isolated by PCR with the upstream...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Cross-lingual Parse Disambiguation based on Semantic Correspondence" pptx
... Disambiguation based on Semantic Correspondence Lea Frermann Department of Computational Linguistics Saarland University frermann@coli.uni-saarland.de Francis Bond Linguistics and Multilingual ... parsers and a machine translation system. We reduce ambiguity for all sentence pairs where a parse could be cre- ated for both languages, and for which there was at least a partial t...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: "Predicting Unknown Time Arguments based on Cross-Event Propagation" ppt
... 3 Motivation The events in a news document may contain a temporal or locative dimension, typical about an unfolding situation. Various situations are evolv- ing, updated, repeated and corrected ... “Propagate/Not-Propagate” for each sample. The annotation for both training and test sets took one human annotator about 10 hours. We asked an- other annotator to label the 10 test t...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: Medium-chain dehydrogenases/reductases (MDR) Family characterizations including genome comparisons and active site modelling pdf
... NADP(H) as cofactor and several but not all of the members have one zinc ion with catalytic function at the active site. Some, in particular classical, dimeric ADHs, also have a second zinc ion ... human and A. thaliana sequences are presently lacking. Furthermore, COG groups the YADH and CAD families together in COG 1064, and the MRF and QOR families together in COG 0604. COG a...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf
... kinase. DNA polymerase assays A standard reaction (15 lL) contained 4 lm each of the primer and template and 1 mm each of deoxynucleoside tri- phosphate, DNA polymerase and the corresponding reac- tion ... different polymerases on the stimulation of a triplet repeat expansion. A standard reaction (23 °C, 24 h) containing 5¢- 32 P- end-labeled (AAT) 3 and unlabeled template (AT...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: "Cross-Language Document Summarization Based on Machine Translation Quality Prediction" pdf
... summarization methods can be gener- ally categorized into extraction -based methods and abstraction -based methods. In this paper, we focus on extraction -based methods. Extraction- based summarization ... The translation quality is an overall measure for both the translation accuracy and the readability of the translated sentence. The score ranges between 1 and 5, and 1 me...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: "Deverbal Compound Noun Analysis Based on Lexical Conceptual Structure" potx
... (load) and ‘jisoku’ (flux) are ‘+AL’, and ‘kakusan’ (diffusion) and ‘senkei’ (linearly) are ‘-AL’. (‘AL’ stands for alternation verbs.) UA ‘jiki’ (magnetic) and ‘joutai’ (state) are ‘+UA’, and ‘junjo’ ... categorized as ‘-EC’ but ‘ +ON , the modifier in kikai-hon’yaku (machine-translation) is analyzed as adjunct (that means ‘translation by a machine’), and the modi- fier in kikai-s...
Ngày tải lên: 08/03/2014, 04:22
Tài liệu Báo cáo khoa học: Structural bases for recognition of Anp32⁄LANP proteins doc
... 6998–7002. 7 Radrizzani M, Vila-Ortiz G, Cafferata EG, Di Tella MC, Gonzalez-Guerrico A, Perandones C, Pivetta OH, Carminatti H, Idoyaga Vargas VP & Santa-Coloma TA (2001) Differential expression of ... )2.44 Ramachandran plot appearance )2.77 v1–v2 rotamer normality )0.12 Backbone conformation )1.69 Procheck Ramachandran statistics (%) Most favored region 75.1 Additional allowed regions...
Ngày tải lên: 18/02/2014, 17:20