Báo cáo khoa học: "Partially Specified Signatures: a Vehicle for Grammar Modularity" pdf

Tài liệu Báo cáo khoa học: "At-Least-N Voting Improves Recall for Extracting Relations" pdf

Tài liệu Báo cáo khoa học: "At-Least-N Voting Improves Recall for Extracting Relations" pdf

... Extracting Relations Nanda Kambhatla IBM T.J. Watson Research Center 1101 Kitchawan Road Rt 134 Yorktown, NY 10598 nanda@us.ibm.com Abstract Several NLP tasks are characterized by asymmetric data where ... asymmetry in the data and the imbalance between precision and recall in the classifiers. 4 The ACE Relation Extraction Task Automatic Content Extraction (ACE) is an annual evaluation conduct...

Ngày tải lên: 20/02/2014, 12:20

7 289 0
Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx

Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx

... Topological Dependency Grammar. Fig. 5. Dependency and phrase structure for (5b) 3.1 Definition of the Grammar For a grammar, the parameters to instantiate are the vocabulary V, the set of (lexical) cate- gories ... Example of a grammar We will now instantiate our formalism for the German grammar fragment described in sec- tion 2 (leaving aside non-verbal elements in the ri...

Ngày tải lên: 20/02/2014, 18:20

8 575 0
Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

... any map- pee events. Mental/Emotional States VNMA: If some agents in the source domain have mappees that are also agents, then their mental and emotional states map identically, provided that ... reaches of her mind, Anne knew Kyle was haying an affair, but "to acknowl- edge the betrayal would mean I'd have to take a stand." We suggest that a likely informational contri- b...

Ngày tải lên: 22/02/2014, 02:20

6 455 0
Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

... canola (Bras- sica napus and Brassica rapa) and vegetables such ase cabbage (Brassica oleraceae var. capitata), cauliflower (B. oleraceae var. botrytis) and broccoli (B. oleraceae Keywords brassinin; ... brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola M. Soledade C. Pedras, Zoran Minic and Vijay K. Sarma-Mamillapalle Departm...

Ngày tải lên: 18/02/2014, 14:20

17 596 0
Tài liệu Báo cáo khoa học: Substrate specificity of the pseudouridine synthase RluD in Escherichia coli doc

Tài liệu Báo cáo khoa học: Substrate specificity of the pseudouridine synthase RluD in Escherichia coli doc

... was amplified by PCR using Pwo polymerase (Roche Diagnostics GmbH, Mannheim, Ger- many) and primers rluD114::cat(pKD3) 5¢ (5¢-GCT ACA ATA GCA CAC TAT ATT AAA CGG CAA AGC CGT AAA ACC CC G TGT AGG ... CTG GAG CTG CTT CG- 3¢) and rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AAT GTG AAA AGA AAA TCA CGC GTA CCG GAT CGT CTT G AT GGG AAT TAG CCA TGG TCC-3¢) (comple- mentary regions to the rluD-flanking ... o...

Ngày tải lên: 18/02/2014, 16:20

8 597 0
Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc

Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc

... 5¢-GCTATTGTGGTAGAATA CATATG AGACAC-3¢, sense, and 5¢-GGAGTTGTAAAAATTC GAATTCTAAAGAGC-3¢, antisense (the introduced restric- tion sites are underlined). Isolated genomic S. solfataricus DNA (20 ng), hydrolyzed ... sealed glass vials at temperatures in the range 90–110 °C in an oil bath. Samples (2 lg) were taken at time intervals and residual activity was deter- mined by the standard assay at...

Ngày tải lên: 18/02/2014, 17:20

15 557 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

... biofunctionalities of these materials. Acknowledgements Authors thank Dr S. Subramanian (Indian Institute of Science, Bangalore) for X-ray analysis, Dr A. G. Appu Rao and Dr Sridevi Annapurna Singh (Department ... Watanabe,T.,Kobori,K.,Kiyotaka,Miyashita,Fujii,T.,Sakai, H. & Makot, Uchida and Tanaka, H. (1993) Identification of glutamic acid 204 and aspartic acid 200 in chitinase A1 of...

Ngày tải lên: 19/02/2014, 12:20

11 674 0
Báo cáo khoa học: Calcite-specific coupling protein in barnacle underwater cement docx

Báo cáo khoa học: Calcite-specific coupling protein in barnacle underwater cement docx

... CCA GCA CCG GTG G)-3¢ for reverse tran- scription; 5¢-(AAA CAG TAA GGC CAG CGT AT)-3¢ and 5¢-(GCA TCA TGA TCA CGG AAA GA)-3¢ for the first PCR amplification; and 5¢-(TGA TGG CAA TGT GAT GTT GA)-3¢ ... grade available and purchased from Wako Pure Chemical Industries (Osaka, Japan). ASW was prepared by dissolving Marine Art SF (Senju Seiyaku Co., Osaka, Japan) in ultrapure water that had been...

Ngày tải lên: 07/03/2014, 05:20

11 471 0
Báo cáo khoa học: Site specificity of yeast histone acetyltransferase B complex in vivo pot

Báo cáo khoa học: Site specificity of yeast histone acetyltransferase B complex in vivo pot

... plus QMA cartridges (Waters, Milford, MA, USA), and employed for the in vitro HAT specificity assays. HAT assays For determination of enzymatic activity in chromatographic fractions, a new assay method ... assays (Fig. 8A) . As a control, equivalent chromatographic fractions from a hat1D mutant strain were also assayed. A recombinant yeast Hat1 (ryHat1) was also included in the ass...

Ngày tải lên: 07/03/2014, 05:20

15 385 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

... NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting DNA spanning ... 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG TC-3¢. For NKA49: forward, 5¢-CTTCCACGACGGAAAC GATGAC-3¢; reverse, 5¢-CTCTCCAACACATGCTGACG TAG-3¢. Cycling conditions were 94...

Ngày tải lên: 07/03/2014, 12:20

10 639 0
Từ khóa:
w