Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus inﬂuenzae pot

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The ... heme–GmHO-1 initiates the reaction, as revealed by gradual diminution of the Soret band. After several minutes, a broad bandappears at around 660–675 nm; this increases in inten-sity with time, indicating ... estimated directly from the values of absorbance at these maxima (data notshown). The estimated association constants for imi-dazole and azide binding to heme–GmHO-1 are sum-marized and compared...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ... and complementary mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and ... lies at the dimer interface of PfTIM,appears to be important in promoting subunit dissocia-tion [27] and also in maintaining the geometry of the active site. The availability of crystal structures...

Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

... sites. In the case of the titin and twitchinkinases, the autoinhibitory sequence acts as a pseudo-substrate, occluding ATP binding and preventingprotein substrates from binding (reviewed in [9]).PhK ... An intrinsic calmodulin (CaM, the dsubunit) binds directly to the c protein kinase chain. The interaction site of CaM on c has been localized to a C-terminal extension of the kinasedomain. ... molar ratio of Ca2+⁄ CaM to PhK5had been reached. The inset shows an expanded view of the indi-cated area of the spectrum. (Bottom) An overlay of spectra from the titration of Ca2+⁄ CaM...

Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

... thioester acyl–enzymeintermediate. Biochemistry 49, 341–346.3 Fukuda A, Matsuyama S, Hara T, Nakayama J,Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine is essential for ... than that from RN4220, MW2 or MSSA476 strain, indicatingthat shorter fatty acids were mainly attached to the tria-cylated lipopeptides of SitC of the SA113 strain(Figs 1A and 3). The usage of ... strain wasreported to be diacylated [11], we then asked whether the SitC lipoproteins of three other strains of S. aur-eus, including SA113 strain, and of S. epidermidisATCC12228 strain are...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... macromolecule-64(OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of thisprotein, we revealed that the aggregate also contains the inner ear-speciﬁc collagen otolin-1 [9].ResultsCloning ... However, the structural and biochemicalbases of the biomineralization framework and mineral-associated protein have not been elucidated.On the other hand, vertebrates possess collagens as a main ... to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the proteinand that of its DNA are similar to those of starmaker, a protein involvedin...

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the ﬁbronectin-binding adhesins ﬁbronectin-binding protein A and ﬁbronectin-binding protein B from Staphylococcus aureus pot

... staphy-lococcal adhesins, comprising an N-terminal region that binds ﬁbrinogenand elastin, and a C-terminal domain that interacts with ﬁbronectin. The C-terminal domain of ﬁbronectin-binding ... FEBSMonoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB. Analysis of mAbs binding to the recombinant FnBR indicated the generation ... Den-mark) for 45 min. The binding of the secondary antibodywas quantiﬁed by adding the substrate o-phenylenediaminedihydrochloride and measuring the resulting absorbanceat 490 nm in a microplate...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. The primers were designed to introduce ... coordi-nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or anaspartate. The apparent conﬂict of this ﬁnding with the absence of a coordinating carboxylate ... calcu-lated from the V ⁄ [E] ratio (where V is the reaction rateand [E] is the molar concentration of the 16 kDaprotein subunit) increased linearly with increasingfractional saturation of the...

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... [46]. Other sta-tistical approaches analysing structural parameters in large samples of dissimilar proteins regarding the originand temperature range, do not show signiﬁcant trendsregarding the ... adequate to maintain their activeconformation. In order to improve the understanding of the struc-tural principles of temperature adaptation we studied a subtilisin-like serine proteinase from ... adaptation [34]. The results have given rise to ongoing mutagenic research in which single and combined amino acid substitutionsaimed at increasing the stability of the Vibrio protein-ase are...

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... resultant binding and selective alkyla-tion leading to a depletion of mtDNA in intact cells(Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating ... supercoiled, linear andrelaxed-circular plasmid DNA, in order of increasingapparent molecular weight (Fig. 3A) . Comparison of the ethidium ﬂuorescence (Fig. 3A) and the amount of DNAalkylation (Fig. ... entirely wrap mtDNA and cause a markedincrease in nuclease resistance in vitro [54]. Similartargeting of PNAs to mitochondria also failed to showinhibition of mtDNA replication in intact cells...

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modiﬁcation sites and structural requirements for substrate processing and subcellular localization pptx

... protease core) had a C-terminal hexahistidine tag. The catalytic domain was expressed as a GST-6XHis N-terminal fusionprotein. Variants designed for expression in mammalian cells hadan N-terminal ... require the interactionwith a rapidly titrated endogenous factor, rather than a NLS [46]. Remarkably, the TRAF domain of USP7also interacts with several nuclear proteins such as p53,mdm2 and the ... whereas in cells evidence was obtained pointing to oligomeriza-tion events. Deletion of the N- and C-terminaldomains of USP7 affected the activity of the enzyme,with the C-terminus having a major...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX BT Tieng anh 6 UNIT 2 chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật