Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf
Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf
... the ACL-IJCNLP 2009 Conference Short Papers, pages 193–196, Suntec, Singapore, 4 August 2009. c 2009 ACL and AFNLP A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search Janara ... 22% better images. 2 Background IDIOM makes heavy use of a sense disambiguated, vastly multilingual dictionary called PANDIC- TIONARY (Mausam et al., 2009). PANDIC- TIO...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: LRRK2 in Parkinson’s disease: in vivo models and approaches for understanding pathogenic roles pdf
... cerebral cortex, hippocampus, striatum, amygdala, cerebelluam and olfactory bulb, as well as in ventral tegamental area and substantia nigra (albeit at low lev- els) [11,34–40]. Analysis of LRRK2 ... Huaibin Cai, Xianting Li and Sarah Funderburk for their critical comments, and Dr Huaibin Cai for sharing unpub- lished results. I am also grateful to Dr Nina Pan for assisting in the prepa...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: K4, K9 and K18 in human histone H3 are targets for biotinylation by biotinidase pdf
... M, Ohira M, Ohki M, Kudoh J, Kawasaki K, Shibuya K, Shintani A, Asakawa S, Minoshima S, Shimizu N, Nari- sawa K, Matsubara Y & Suzuki Y (2001) Structure of human holocarboxylase synthetase gene ... K9 and K18 in human histone H3 are targets for biotinylation by biotinidase Keyna Kobza 1 , Gabriela Camporeale 1 , Brian Rueckert 1 , Alice Kueh 1 , Jacob B. Griffin 1 , Gautam Sarath 2 and...
Ngày tải lên: 23/03/2014, 15:20
Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt
... 1,5-diamino-2-pentyne (DAPY). The unsymmetrical DAPY comprises both a propargyl and homopropargyl amine. DAPY was synthesized and tested as a substrate of two plant CAOs. DAPY acts as a mechanism-based inhibitor ... mg, added as a concentrated solution in the same buffer) and the mixture was incubated at 30 °C for 12 h. After that, the same amount of GPAO was added again and the inc...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... Ulbrich A, Matsuda A, Reddy VA, Orth A, Chanda SK, Batalov S & Joazeiro CA (2008) Genome-wide and functional annotation of human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates ... Y, Minoshima Y, Hatori T, Tsuchiya A, Kiyono M, Nosaka T et al. (2006) Rac1 and a GTPase- activating protein, MgcRacGAP, are required for nuclear translocation of STAT transcr...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA Vps4–TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA Vps4–TRP R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4–RDF F GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG Vps4–RDF R CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table ... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1 ⁄ VPS4...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... pair (5¢-ATGGAGGCCGGAGATTTCAAAG-3¢, +1 to +22 bp; and 5¢-ACGGGCTTTAAGTATTTCATCAGGC-3¢, +1405 to +1428 bp) and actin primer pair (5¢-TTCGAGCAG GAGATGGCCACC-3¢ and 5¢-GAGATCCACATCTGYTG GAAGGT-3¢). ... of calcium oxa- late monohydrate on uric acid crystals at sustained supersaturation. Cryst Res Technol 39, 699–704. 28 Srinivasan S, Kalaiselvi P, Sakthivel V, Pragasam V, Muthu V & Varalakshm...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf
... Committee for E thics of Experi- mentation and Animal Care. Preparation of postnuclear fractions and SDS/PAGE analysis The livers and intestinal mucosa from wild (C57BL) or PPARa-null mice fed a control ... a dministration of a PPAR a ligand, postnuclear fractions of the liver and intestine were prepared from mice fed a PPARa ligand for 5 days. The result of one- dimensional SDS...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: EspB from enterohaemorrhagic Escherichia coli is a natively partially folded protein pptx
... enterohaemorrhagic Escherichia coli is a natively partially folded protein Daizo Hamada 1 , Tomoaki Kato 1,2 , Takahisa Ikegami 3 , Kayo N. Suzuki 1 , Makoto Hayashi 2 , Yoshikatsu Murooka 2 , Takeshi ... Honda 4 and Itaru Yanagihara 1 1 Department of Developmental Infectious Diseases, Research Institute, Osaka Medical Center for Maternal and Child Health, Japan 2 Department of Biotechn...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf
... RDH13–His6 was raised at Alpha Diagnostics International Inc. (San Antonio, TX, USA). For western blot analysis of RDH13 expression, samples of human tissue obtained from the Anatomical Gift ... and has a much greater catalytic efficiency as a reductase than as a dehydrogenase. The catalytic efficiency of RDH13 as a retinaldehyde reductase is significantly lower than that of a rela...
Ngày tải lên: 23/03/2014, 07:20