Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

... 2005 FEBS 3959 Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data Kwang-Hyun Cho 1,2 , Sung-Young Shin 3 and Sang-Mok Choo 3 1 ... such time-series experimental data containing (partially) cor- rect dynamic pattern changes then we can infer the (partial) interaction structure of...
Ngày tải lên : 07/03/2014, 21:20
  • 10
  • 375
  • 0
Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx

Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx

... maximal mAb ⁄ heparin effect on the functional activ- ity of TC. Arrows show the hypothetical movement of the domains after attachment of Cbl, see the main text. Mapping of transcobalamin using antibodies ... Geremia S & Randaccio L (2001) Crystallization and preliminary X-ray diffraction analysis of human transcobalamin, a vitamin B 12 -transporting protein. Acta Cr...
Ngày tải lên : 20/02/2014, 01:20
  • 12
  • 514
  • 0
Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

... GCCCCATGGCGGTGGATGGCATATGGGAGG GGGTACCC PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC TCAAGC PrP113–231 CCAACCTCAAGCATATGGCAGGG PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC PrPD112–136 ... and deletion mutants indicate the relative importance of these domains to PrP’s SOD-like activity. Comparison of data presented in Tables 2 and 3 indicates that there ar...
Ngày tải lên : 21/02/2014, 00:20
  • 9
  • 498
  • 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction. The interaction of Pex1p and Pex6p involves their first AAA-cassettes ... comprising the N-terminal fragment and the first AAA-cassette of PEX6 (PEX6N + D1–GAL4-BD). Neither of the cas- settes alone nor the two AAA-cassettes together or the N-...
Ngày tải lên : 07/03/2014, 16:20
  • 12
  • 584
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... (Grenoble, France) using a wavelength of 1.04 A ˚ . The data were inte- grated using mosflm [29] and scaled using scala from the ccp4 software suit [30]. The structure was so...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... protects the PDGFs against proteolytic degradation, and may remove the PDGFs from circula- tion via a 2 -macroglobulin receptors. There are no data currently available about interactions between the ... longer variant containing the CUB domain and the final 30 residues in the C-terminal end of the growth factor domain. These splice variants are also present in human thyro...
Ngày tải lên : 19/02/2014, 07:20
  • 19
  • 557
  • 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... cagC and cagf reached values analogous to genes important for bacterial survival and homeostasis, such as catalase, urease and NapA; by contrast, the transcript abundance of other cag genes appeared ... lymphoma [1–3]. CagA, a major anti- genic factor of the bacterium, is the main signature of the cagPAI-positive strains. Indeed, cagPAI confers H. pylori the capability to ex...
Ngày tải lên : 06/03/2014, 00:21
  • 9
  • 496
  • 0
Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... have therefore measured the thermodynamic parameters of RNase -A in the presence of these amino acids and amino acid derivatives, and values of DG D °, measured in triplicate, are given in Table ... Sigma. These and other chemicals, which were of analytical grade, were used without further purification. Dialysis and the determination of the concentration of protein An RNas...
Ngày tải lên : 07/03/2014, 00:20
  • 9
  • 547
  • 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ Y. Sun et al. ... as sense and antisense, respectively, for each mutation. p26 mutation Primer R110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3...
Ngày tải lên : 07/03/2014, 12:20
  • 15
  • 515
  • 0
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... P763 (5¢-TTCTCGAGACGCGTTATCGATAGAGAAATGT TCTGGC-3¢) and digested the PCR product with EcoRI and XhoI. The insert was synthesized with primers P764 (5¢-AACTCGAGGCTAGTCTGCAGGAGCTCAAGCT TTCTAGAGAATTCA-3¢)andP765(5¢-TGAATTCTC TAGAAAGCTTGAGCTCCTGCAGACTAGCCTCGA GTT-3¢). ... pLuc. The minimal promoter containing TATA box was amplified from pcDNA6/V5-HisA vector (Invitrogen) by primers P768 (5...
Ngày tải lên : 07/03/2014, 15:20
  • 10
  • 671
  • 0