Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... Journal 272 (2005) 3424–3440 ª 2005 FEBS BMP/ activin pathway in Crassostrea gigas A. Herpin et al. Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins ... proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/ activin pathway Amaury Herpin 1,2 , Christ...

Ngày tải lên: 07/03/2014, 21:20

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) ... The core of the pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmo...

Ngày tải lên: 18/02/2014, 14:20

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ Y. ... (2001) The expanding family of Arabidopsis thaliana small heat stress proteins and a new family of proteins containing a- crystallin domains (Acd pr...

Ngày tải lên: 07/03/2014, 12:20

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... interpreted as GMP because the N2 of the base makes a hydrogen bond to a main chain car- bonyl. Binding of a xanthine base from XMP in the same position, would lead to...

Ngày tải lên: 15/02/2014, 01:20

... and part of the His-tag was observed in the B chain. A few amino acid residues are found in disallowed regions in the Ramachandran plot; these are A4 , A1 65, A1 67, B3, B4 and F165, all of which are ... main-chain and medium side-chain restraints. Model building was carried out in o [29] and coot [30]. In chain A, residues 1 and 169–176 are missing; in c...

Ngày tải lên: 18/02/2014, 16:20

... brain and in the adult brain it was expressed in several anatomical nuclei. PDGF-D mRNA is expressed in the developing rat eyes and also adult eyes of rat, cow, monkey and rab- bit. In the adult ... domain and the final 30 residues in the C-terminal end of the growth factor domain. These splice variants are also present in human thyroid papillary carcinomas...

Ngày tải lên: 19/02/2014, 07:20

... other Cag proteins both belonging to the core apparatus, includ- ing CagX, CagY, CagT, CagV and Cagd, as well as other Cag components such as the ATPase CagE, CagF, CagG, CagZ and CagS [16]. In ... in the translocation as a putative effector protein rather than being a component of the T4SS apparatus. Finally, interaction studies indicated that CagI might interact with...

Ngày tải lên: 06/03/2014, 00:21

... Additionally, point mutations in WalkerB of D2 in both AAA-peroxins AB DC EF Fig. 4. Effects of point mutation of the WalkerA and B motifs of the AAA-cassettes of Pex1p on the morphological appearance of peroxisomes. ... to the cassette structure of the proteins. We assigned the binding sites of these two AAA -proteins to their different protein regions an...

Ngày tải lên: 07/03/2014, 16:20

... reveals functional simi- larities and differences between Iba1 and Iba2. We investigated Ca 2+ binding and homodimerization of Iba1 and Iba2. Furthermore, F-actin binding and cross-linking assays ... truncation mutant of neurabin-2 (E). Fig. 6. Calcium-binding assay for Iba1 and Iba2. Iba1, Iba2 and calmodulin where dialyzed against 100 l M CaCl 2 and a trace amount...

Ngày tải lên: 16/03/2014, 06:20

... CORE, the LID and the NMP bind [1]. A characteristic of bacterial CMP kinases is an extension of the NMP bind domain by 40 amino acid residues forming a three-stranded antiparallel b sheet and ... phosphoenolpyruvate, 0.2 mm NADH, different concentrations of ATP and NMPs, and 2 units each of pyruvate kinase, lactate dehydrogenase and NDP kinase (forward reaction)....

Ngày tải lên: 16/03/2014, 10:20