Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... Journal 272 (2005) 3424–3440 ª 2005 FEBS BMP/ activin pathway in Crassostrea gigas A. Herpin et al. Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins ... proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/ activin pathway Amaury Herpin1,2, Christophe Lelong2, Thomas Becker1, Frederic Rosa3, Pascal Favrel2 and ... through a complete, original and functional BMP ⁄ activin path-way in lophotrochozoans, for which a singular and promiscuous type II receptor would be the shared interface for both BMP and activin...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... The core of the pro-tein is made up of a nine-stranded b-sheet ﬂanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella typhimurium SurE A. Pappachan et al.5856 ... Billerica, MA, USA).Initial characterization of the protein The purity and molecular mass of the protein were checkedby 12% SDS ⁄ PAGE and MALDI-TOF MS. Gel-permeationchromatography with 200 lLofa1mgÆmL)1protein...

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. ... (2001) The expanding family of Arabidopsis thaliana small heatstress proteins and a new family of proteins containing a- crystallin domains (Acd proteins) . Cell Stress Chaper-ones 6, 225–237.9 Narberhaus ... Chaperones 8, 381–394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- and aB-crystallins with early and late unfolding intermedi-ates of citrate...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... interpreted as GMP because the N2 of the base makes a hydrogen bond to a main chain car-bonyl. Binding of a xanthine base from XMP in the same position, would lead to the loss of a hydrogenbond and a ... with guanine and hypoxanthinebases, respectively, indicating that Asp137 functions as a catalytic base [12]. However, a tight binding of N7 of the purine base and Asp137 was observed in HPRTin...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... and part of the His-tag was observed in the B chain. A fewamino acid residues are found in disallowed regions in the Ramachandran plot; these are A4 , A1 65, A1 67, B3, B4 and F165, all of which are ... main-chain and medium side-chain restraints. Modelbuilding was carried out in o [29] and coot [30]. In chain A, residues 1 and 169–176 are missing; in chain B, residues 167–172 are missing; in ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP. In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and...

Tài liệu Báo cáo khoa học: Structural and functional speciﬁcities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... brain and in the adult brain it wasexpressed in several anatomical nuclei.PDGF-D mRNA is expressed in the developing rateyes and also adult eyes of rat, cow, monkey and rab-bit. In the adult ... domain and the ﬁnal 30residues in the C-terminal end of the growth factordomain. These splice variants are also present in human thyroid papillary carcinomas (L. J. Reigstad,J. E. Varhaug and ... contain dibasiccleavage sites for proteolytic removal of the CUBdomains and thereby activation of the growth factordomains. PDGF-C and -D contain both the CUB and growth factor domains when they...

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... other Cag proteins both belonging to the core apparatus, includ-ing CagX, CagY, CagT, CagV and Cagd, as well asother Cag components such as the ATPase CagE,CagF, CagG, CagZ and CagS [16]. In ... in the translocation as a putativeeffector protein rather than being a component of the T4SS apparatus. Finally, interaction studies indicatedthat CagI might interact with CagZ and CagG, and weak ... detected at all. Interestingly, the expressionlevels of cagC and cagf reached values analogous togenes important for bacterial survival and homeostasis,such as catalase, urease and NapA; by contrast,...

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... Additionally, pointmutations in WalkerB of D2 in both AAA-peroxinsABDCEFFig. 4. Effects of point mutation of the WalkerA and B motifs of the AAA-cassettes of Pex1p on the morphological appearance of peroxisomes. ... to the cassette structure of the proteins. We assigned the binding sites of thesetwo AAA -proteins to their different protein regions and elucidated the importance of ATP-binding to the two AAA-cassettes ... 2004 FEBS Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6pIngvild Birschmann1,*,†, Katja Rosenkranz2,†, Ralf Erdmann2 and Wolf-H Kunau11 Abteilung...

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... reveals functional simi-larities and differences between Iba1 and Iba2. Weinvestigated Ca2+binding and homodimerization of Iba1 and Iba2. Furthermore, F-actin binding and cross-linking assays ... truncation mutant of neurabin-2 (E).Fig. 6. Calcium-binding assay for Iba1 and Iba2. Iba1, Iba2 and calmodulin where dialyzed against 100 lM CaCl2 and a traceamount of 45CaCl2. Upon dialysis, ... membrane rufﬂing and phagocytosis[3] and to enhance the interaction of Iba1 with F-actinto a certain degree [11]. In this study F-actin binding and cross-linking by Iba proteins was calcium indepen-dent,...

Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf

... CORE, the LID and the NMPbind[1]. A characteristic of bacterial CMP kinasesis an extension of the NMPbinddomain by 40 aminoacid residues forming a three-stranded antiparallelb sheet and ... phosphoenolpyruvate, 0.2 mmNADH, different concentrations of ATP and NMPs, and 2 units each of pyruvate kinase, lactate dehydrogenase and NDP kinase (forward reaction). The rate was calculatedassuming that ... to the N3atom of cytosine. As the main chain carbonyl of D129, a H-bond acceptor, interacts with the terminaloxygen of S36 side chain, the latter can only behaveas a H-bond acceptor with the...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ