Báo cáo khoa học: Emergence of a subfamily of xylanase inhibitors within glycoside hydrolase family 18 pdf
... interaction between GH10 A. nidulans xylanase and the two inhibitors. (i) A. nidulans xylanase; (ii) a mixture of A. nidulans xylanase and RIXI; (iii) a mixture of A. nidulans xylanase and rXIP-I. For ... originally classified as a rice class III chitinase and analyze the features that allow discriminating the subfamily of xylanase inhibitors within the large GH...
Ngày tải lên: 07/03/2014, 17:20
... Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into the EcoRV site of ... that mammalian Gup1, a mem- ber of the MBOAT superfamily bearing sequence simi- larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports have demo...
Ngày tải lên: 18/02/2014, 16:20
... annotated instances. In contrast, our study focused on a se- lect group of nominal predicates, each associated with a large number of annotated instances. 3 Data annotation and analysis 3.1 Data annotation Implicit ... Morristown, NJ, USA. Association for Com- putational Linguistics. Patrick Pantel and Deepak Ravichandran. 2004. Automatically labeling semantic classes. In Daniel Marcu...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf
... services that are being developed, in all or part, and main- tained at the University of Lisbon, Department of Informatics, by the NLX-Natural Language and Speech Group. At present, it makes available ... service takes a Portuguese nomi- nal form — a form of a noun or an adjective, in- cluding adjectival forms of past participles –, to- gether with a bundle of inflectional fe...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC YEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG IRA ... Table 2. Primers used for mutagenesis. Primer Sequence (5¢-to3¢) Vps4 Upstr F CGCTGCAGTAAGAGCAGTAAACCCG Vps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAA...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc
... trehalose, turanose, raffi- nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc, pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St. Louis, MO, USA). Galactomannans ... and superimposition of an equilibrium mixture of a- and b-galactose from Oryza sativa a- galactosidase [28], N-acetyl -a- galactosamine from Gallus gallus a- N-acet- ylgalactosaminidase [29...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx
... can motivate a speaker to use a variant in place of a canonical form (Glucksberg, 1993). Nevertheless, lexical and syntactic flexibility may well be used as partial indicators of semantic ana- lyzability, ... defined as phrases or sentences that involve some degree of lexical, syntactic, and/or semantic idiosyncrasy. Idiomatic expressions, as a part of the vast fam- ily of figu...
Ngày tải lên: 31/03/2014, 20:20
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... bp was produced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose ... DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢. One strand...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... support may have advantages over hand-written prescribing (HWP) in terms of standardisation, full audit trail, legibility, use of approved names, specification of key data fields such as route of admin- istration, ... did not affect the patient but, in these cases, nurses administered medication without a legally valid physi- cian order. Although an absent 'signature' with...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... domain and the functional relationship of tandemly repeated domains in BPPs. We conjecture that dual-domain BPPs have succeeded evolutionarily because they can increase the amount of available ... was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 min when assayed at 35 °C (Fig. 3A, B). The presence of Ca 2+ increased the thermal stability of Ph...
Ngày tải lên: 14/02/2014, 15:20