Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family Ste´phane Canaan1, Damien Maurin1, ... iscomposed of 7 parallel b strands associated to an anti-parallel strand (b2) and is surrounded by 5 helices (a1 , a2 , a3 , a7 anda8). T he second domain c onsists of helices a4 , a5 and a6 a ll clustered ... and a c harge r elayingaspartic (or glutamic) acid. To further investigate the biochemical characterization of the enzyme, we havetitrated these key residues that form the catalytic triad of Rv1399c. Catalytic...

Báo cáo khoa học: Expression and characterization of the bioﬁlm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

... binding ACTATTGATGAAGCCGCGGGCATGACAGGTGCD17 3A Zinc binding CCTTCTAAATACAGCTAGCGAACAAGAAGGCGH46 1A Zinc binding CCAACCATCAAGTTCCCTGCTAGCCCAGATGAG Characterization of V. alginolyticus PepD T Y. Wang ... CGCTCGGGGCAGCTAACGGCATCGGCATGGCD119X Zinc binding CGCTCGGGGCANNNAACGGCATCGGCATGGCE14 9A General base CTGACGATCGATGCAGAAGCAGGCATGACAGGE149X General base CTGACAATTGATNNNGAAGCAGGCATGACAGGE15 0A Zinc ... decays to the product after one additional proton transfer from the catalytic Glu149 carboxylate to the amide nitrogenin His219.On the other hand, although the results from ourmutational analysis...

Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

... discovered as a part of the interferon antiviral pathway in mammals [1,2]. Inhigher animals (vertebrates), when activated bydsRNA, 2- 5A synthetases catalyze the polymerization of ATP into unusual 2¢,5¢-linked ... optimal for the nuclease (high NaCl and phosphate concentrations and the absence of Mg2+).Another nuclease treatment was carried out afterpuriﬁcation and dialysis of the recombinant protein (i.e. ... synthetasepreparations.RNA binding of the sponge recombinant 2- 5A synthetaseAll known vertebrate 2- 5A synthetases are known to be activated by their cofactor, dsRNA. Therefore, weperformed activity...

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

... Fig. 7, panel A. Addition of ascorbate to the heme–Syn HO-1 complexcommences the reaction, which is monitored by the steadydecrease of the Soret and 498 nm bands and the shift of the band at 630 ... gauss isattributable to the 14N nuclei of the axial ligand trans to the nitrosyl ligand. This ﬁrmly establishes that the proximalligand of the heme–Syn HO-1 complex is a nitrogenous base. The ... the decrease of Soret band at 410 nm and to the increases of broad band spreading 600–700 nm. The latter band was conﬁrmed to belong to biliverdin IX a by the HPLC analysis (data not shown).DiscussionOverall...

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... Psaridi-Linardaki L, Trakas N, Mamalaki A & TzartosSJ (2005) Speciﬁc immunoadsorption of the autoantibo-dies from myasthenic patients using the extracellulardomain of the human muscle acetylcholine ... Tzartos SJ, Barkas T, Cung MT, Mamalaki A, Mar-raud M, Orlewski P, Papanastasiou D, Sakarellos C,Sakarellos-Daitsiotis M, Tsantili P, et al. (1998) Anat-omy of the antigenic structure of a ... amounts of the ECDs of the non -a sub-units of human muscle AChR for use as starting material for the determin-ation of the 3D structure of the receptor ECDs and for the characterization of the...

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... and XhoIML2p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGGTCCCGGCATAC-3¢NdeI and XhoIML3p A- chain5¢-GATATACATATGTACCGTCGTATTAGCCTTCGTGTCACGGAT-3¢5¢-CACACGAATTCTTATTAAGAAGAAGAAGAACGGTCCCTGCATAC-3¢NdeI and EcoRIML3.1p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACGAATTCTTATTAAGAAGAAGAAGAACGGTCCCTGCATAC-3¢NdeI ... cloningML1p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGCTCACCGCA-3¢NdeI and XhoIML2p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGGTCCCGGCATAC-3¢NdeI ... (UTR)obtained by RACE. The sequences of the primers were:5¢AAAATCTAGAGAAGCAAGGAACAATGAATG-3¢(5¢UTR) containing the XbaI recognition site for cloning,5¢-AAAAATGCATGAAGTTGATTGCTTGCATTAACTCAT-3¢...

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... underlined: wt, 5¢-AGAGAGAATGAGAGGCTTCCCAATAGC-3¢;mut1,5¢-AGAGAGAATGATAGGCTTCACAATAGC-3¢;mut2,5¢-AGAGAGAATGATAGGCTTCCCAATAGC-3¢;mut3,5¢-AGAGAGAATGAGAGGCTTCACAATAGC-3¢.Binding reactions were ... derived from the additional sequence obtained in the ﬁrst ampliﬁcation(5¢-GARAAYTTYGARAAYCAYAARAARTTYTAYTG-3¢ and 5¢-AGTTCTAATGCTATGTTTGGATGC-3¢)affor-ded a product of 1.7 kb. Additional screening ... Primers and conditions used for RT-PCR were as follows: XHIVEP1,5¢-ATCCAGAGGCAGAAGCAG-3¢ and 5¢-CTGCATTCAGAGTAAGCC-3¢,60°C, 29 cycles; XHIVEP2,5¢-AAGCAGAGGAATGCAGTAG-3¢ and 5¢-AATGTCTTTCTCTCCATGG-3¢,60°C,...

Báo cáo khoa học: Fatty acid regulation of adenylyl cyclase Rv2212 from Mycobacterium tuberculosis H37Rv doc

... active state(pH 6), the catalytic domains align as a closed dimercapable of binding ATP and of catalysis. In the in-active state (pH 8), the catalytic domains are drawnapart by extended a- helices ... mycobacterial class IIIb ACs, the HAMPdomains appear to directly act as modulators of ACactivity, possibly transmitting signals that may bepicked up by a receptor function of their hexahelicalmembrane ... pH-sensing isoform Rv1264, an N-terminalregulatory domain and a C-terminal catalytic domain. The maximal velo-city of Rv2212 was the highest of all 10 mycobacterial cyclases investigated to date (3.9...

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... cardiac ﬁbrosis in a paracrine manner under ischaemic conditions.Taken together, these ﬁndings may improve understanding of the cellu-lar and molecular basis of the anti-inﬂammatory and paracrine ... transcription and secretion of IL-10Because of the lack of secretion of the inﬂammatorycytokines IL-1b and TNF -a from hypoxia ⁄ SD-stimu-lated MSCs, as well as the signiﬁcant anti-inﬂamma-tory ... which may be an importantmediator of the cells’ paracrine anti-ﬁbrotic effects.These ﬁndings help to improve our understanding of the cellular and molecular basis of MSCs’ anti-inﬂam-matory and...

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially useful inagriculture and medicine because of their antiviralproperties ... displayed hemagglutination and toxicitytoward mice (data not shown), additional efforts to cleanly isolate the isoform were not successful and further characterization was abandoned. A chromato-focusing ... chromatographies, and investigated withrespect to toxicity and sugar binding speciﬁcity. Half maximal inhibitoryconcentration and median lethal dose values indicate that P I and P II havesimilar...

Xem thêm