A SURVEY OF SURVIVING BUILDINGS OF THE KROTONA COLONY IN HOLLYWOOD pdf
A SURVEY OF SURVIVING BUILDINGS OF THE KROTONA COLONY IN HOLLYWOOD pdf
... photograph of it in a state of near completion appeared in the May1913 issue of the American Theosophist magazine.20Nearly all of the working drawings bear Richard Requa’sinitials, and there is reason ... lectures than was available in the Krotona Inn,including a space for the working of the ritual that cameto be known as the Krotona Service.38Its major roomwas therefore a high-ceiling auditorium, ... discovering the spiritual meaningsembodied in Gill’s mature architecture. The use of Moorish styling in the Krotona Inn and most of the other prominent buildings of Krotona may be seenas a strategy...
- 17
- 731
- 0
Anatomy of a Health Scare: Education, Income and the MMR Controversy in the UK doc
... Practitioners/physicians (GPs) per thousand babies, and the average ageamong adults living in the area (as a proxy for the demand for health care).16 The first column of Table 1 shows the mean across all areas and ... that having no qualifications is associated with a lower decline in uptake. However that the authors measure the educational attainment of the economically active population rather than that of the adult ... a further vaccine against meningitis C wasintroduced; since uptake data is only available from 2000 onwards we do not consider this vaccine.10 The data thus contains information about vaccinations...
- 58
- 521
- 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf
... pDU-PABP(s) EarI-catgaaccccagtgcc7 pDU-RBDII(s) EarI-catggatgttataaagggc8 pDU-RBDIII(s) EarI-catgggacgatttaagtct9 pDU-RBDIV(s) EarI-catggaacagatgaaacaa10 pDU-PABPC(s) EarI-catggagcgccaggctcac11 ... PABP, and surpris-ingly we have found that both polypeptides bindstrongly to a 22 nucleotide long CCCAAAAAAAUUUACAAAAAA sequence located at the 3¢ end of the ARS. Furthermore, CCCAAAAAAAUUU wasfound ... was determined tobe within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAAsequence located at the 3¢ end of the ARS. Results of our analysis suggestthat both proteinÆprotein and proteinÆRNA interactions...
- 13
- 466
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... was characterized by western blotting, aminoacid analysis and N-terminal Edman sequencing (datanot shown). MS analysis showed that the isolatedCT-peptide had a molecular mass within 1 Da of ... of anenzyme. In the case of proPC1 ⁄ 3, removal of the var-ious structural and functional domains is a sequentialand coordinated event culminating in removal of the CT-peptide to release the ... Spodoptera frugiperda (Sf)9 cellsexpressing the recombinant mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitatesisolation of the enzyme and helps in maintaining the enzymatic...
- 10
- 305
- 0
Báo cáo " Estimation of emission factors of air pollutants from the road traffic in Ho Chi Minh City " docx
... factors by road traffic. 2. Selection of method for estimating emission factors Based on the analysis of advantages and disadvantages of the currently available methods, it shows that the ... the study area. 5. Conclusions 1. Based on the advantages and disadvantages of methods for determining emission factors combined with the real conditions of HCMC, the authors have used a ... vehicles in HCMC leads to the increase of harmful emissions, as well as the concentration of air pollutants. The calculation of air pollution emission by road traffic for simulating the distribution...
- 9
- 748
- 1
Báo cáo khoa học: Role of different moieties from the lipooligosaccharide molecule in biological activities of the Moraxella catarrhalis outer membrane pot
... Yangzhou,Jiangsu, China†Defence Research and DevelopmentCanada-Suffield, Medicine Hat, Alberta,CanadaDatabase The nucleotide sequence of lgt3 gene in Moraxella catarrhalis strain O35E has beensubmitted ... present in nasal washes were measured atvarious time points postchallenge. The minimum detectablenumber of viable bacteria was 4 CFU per nasal washing.Clearance of M. catarrhalis was expressed as ... to the well. The datarepresent the average of three independent assays.Nasopharyngeal clearance pattern in animalmodelFemale BALB ⁄ c mice (6–8 weeks of age) were obtainedfrom Taconic Farms...
- 10
- 406
- 0
ECONOMIC IMPORTANCE OF THE PLANTATION SECTOR IN KERALA pdf
... Robusta and Arabica are two main varieties of coffee. Kerala is a major Robusta growing belt and has the largest area under this variety. The area under Arabica has stagnated around 3400 hectares ... in Nilgiris, Anamallais, Kaman Devan Hills and over the slopes of mountains stretching down to the plains of Kerala. Table 4.13 shows the State-wise distribution of tea planted areas in the ... all the tea producing countries of the world, India has the largest acreage under the crop. Major tea growing regions are located in Assam and West Bengal in North India and Tamil Nadu and...
- 47
- 406
- 0
Báo cáo khoa học: Structural determinants of protein stabilization by solutes The importance of the hairpin loop in rubredoxins pdf
... toaffect the overall structure, and probably the physiolo-gical function. We should bear in mind, however, that the NMR data was obtained at a temperature lowerthan the stability data and the ... ther-mostability of any given protein [5]. Protein stabilityappears as the result of a delicate balance of stabilizingand destabilizing interactions, with the thermodynamicKeywordscompatible ... then used as input to generate protein conformersusing the program for restrained dynamics and simulatedannealing, dyana v. 1.4 with modifications (indyana)tooptimize scaling factors for calibrating...
- 13
- 405
- 0
The Bronze Age in Ireland pdf
... on the Continent and in Scandinavia; while Scandinavian amber has been found in Ireland. As will be seen on p. 81, the Bronze-Age people were acquainted with the art of weaving; and fineornaments ... have been abandoned, as after a certain number of blows had been delivered, the axe-head would be forced back into the shaft. A more practical method wasto place the head in a handle having a ... spear-head was evolved bydecreasing the width of the base of the dagger-blade, and adding a narrow tang with a peg-hole to fix into the shaft. The addition of a ferule was the next step; and the...
- 61
- 286
- 0
Từ khóa: a profile of the fisheries sector in the regionsocial welfare a history of the american response to need pdfvisions of america a history of the united states volume 1 pdfvisions of america a history of the united states volume 2 pdfservice quality a study of the luxury hotels in malaysiashow me a map of the time zones in the united states of americadiseases of the nervous system in childhood pdfhas attracted increasing attention as a component of amperometriclglutamate sensors used in the food industry and clinical biochemistry the precursor of lgoxa diary of the dyinga tour of the dart librarieschulalongkorn university in thailand this smalllab kit was created as a result of the research project entitled chemistry laboratory based on chemical safety and pollution minimization sponsored by thai research fund rdg 3072543 one of the outcomes of tthe code offers a synthesis of the requirementsa review of the economic approacha list of the parishes in virginiaa generalization of the offlineBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP