Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii Bernard Pineau 1 , Jacqueline Girard-Bascou 2 , Stephan Eberhard 2 , ... the same segregation, as that observed for PSII activity and PG content. Translation initiation of the psbA mRNA is not affected in the mf2 strain The drama...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
... knowledge of RNase II proteins. To date, there are no structural or mutational data available from any other proteins of the family. The SK4803 strain is par- ticularly interesting since the mutant ... (rnb296) encodes an inactive RNase II enzyme [25]. In this report we demonstrate that the single amino acid sub- stitution Asp209fiAsn in RNase II is able to cause the total in...
Ngày tải lên: 30/03/2014, 15:20
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca 2+ - binding site in ... the cDNA data of E. quadrivirgata and A. blomhoffii, indicating that each putative upstream signal sequence containing the first Met residue was 20 aa residues long. About 12% (33/28...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction Paola Turina and B. Andrea Melandri Department ... 1.0 ATP/(F 1 F 0 Æs). These values are from a single preparation of chromatophores but are representative of several preparations, obtained from strains carrying mutat...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... pore-form- ing subunit Orai1 [5]. STIM1 is a single transmem- brane-spanning protein with 685 amino acids which contains a canonical EF-hand motif and a sterile a- motif (SAM) domain in the ER ... synthesis or cleavage. Shaw et al. [9] first reported that an isolated EF-hand III from skeletal troponin C dimerizes in the presence of Ca 2+ . EF- hands from parvalbumin and calb...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline). Name Size (nt) Sequence CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC AT...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: "A Text Understander that Learns" doc
... we may annotate each assertional axiom of the form &apos ;a : C' and &apos ;a R b' by a corresponding hypothesis label h so that (a : C)h and (a R b)h are valid terminolog- ical ... terminological the- ory of a domain. Concepts are unary predicates, roles are binary predicates over a domain A, with individuals being the elements of A. We assume a co...
Ngày tải lên: 17/03/2014, 07:20
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx
... structures indicates that the side chain of K109 plays a dual role by forming a salt bridge to D137, as well as stabilizing a glycine-rich loop in the vicinity of the FMN cofactor. In all protein vari- ants, ... D137L and K109D ⁄ D137K variants adopting a tetrameric assem- bly. Interestingly, all protein variants show a drastically reduced quinone reductase activity in s...
Ngày tải lên: 30/03/2014, 01:20
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx
... and K + deprivation in plants remains to be elucidated. Besides, zeatin and cold treatments also increased the accumulation of AtHELPS mRNA in seedlings (Fig. S1), suggesting that additional roles of AtHELPS might ... impor- tant for cellular ion relationships in natural conditions. Increasing in ux, decreasing efflux or both can maxi- mize K + uptake to maintain K + homeostasis...
Ngày tải lên: 14/02/2014, 18:20
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt
... dv2. andar© v.intran.simple I The other sets of data are contained in the Prolog workspace and are structured as tables of a relational data base. The set of the classes of endings is a table ... by Morreale, Campagnola and MugeUesi, as a research tool for teaching Italian morphology, with applications in automatic processin¢ of 32 natural language and knowledge re...
Ngày tải lên: 24/03/2014, 05:21