Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

... for polyunsaturated fatty acid (PUFA) biosynthesis. FAD, fatty acid desaturase; Elo, elongase; Elo5, D5 elongase; Elo6, D6 elongase; AA, arachidonic acid; EPA, eicosapentaenoic acid; DHA, docosahexaenoic ... exhibits another variation in the first steps of the pathway. C18 FAs are elongated to C20, and then a D8 desaturase produces the same kind of C20 FAs that wil...

Ngày tải lên: 07/03/2014, 12:20

10 476 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed ... coordi- nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or an aspartate. The apparent conflict of this finding with the absence of...

Ngày tải lên: 18/02/2014, 06:20

15 624 0
Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

... Oncometopia nigri- cans, accession number AAU95196; HC, Homalodisca coagulata, AAT01076; AF, Artemia franciscana, AAL55398; ON2, Oncorhyn- chus nerka, AAK08117; SS, Salmo salar, AAB34575; TN, Tetraodon nigroviridis, ... work was supported by the Heart and Stroke Foundation of Nova Scotia, the Natural Sciences and Engineering Research Council of Canada, the Nova Scotia Health Researc...

Ngày tải lên: 16/03/2014, 11:20

9 434 0
Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx

Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx

... were taken as refer- ence or blank. The counts of the radioactive ligand alone in the scintillation liquid cocktail were also measured and these values were taken in the y-axis as total added. The reactions ... consists of the DEF domains of mutant CfEcR (EcRtvy and EcRtvay), GAL4 DNA binding domain and VP16 activation domain. Various combinations of the EcR ligand bindi...

Ngày tải lên: 16/03/2014, 12:20

14 323 0
Báo cáo khóa học: Functional characterization of the evolutionarily divergent fern plastocyanin potx

Báo cáo khóa học: Functional characterization of the evolutionarily divergent fern plastocyanin potx

... Yoshizaki, F., Sasakawa, Y., Onodera, K., Nagatomo, S., Kitagawa, T., Uzawa, S., Isobe, Y., Sugimura, Y., Gotowda, M. & Kai, Y. (1999) The structure and unusual pH dependence of p lastocyanin from ... he amplitude of the fast phase of the l atter represen ted up to 40% of the total amplitude, with a rate constant (k obs ) independent of Pc concentration (data not sho...

Ngày tải lên: 16/03/2014, 16:20

8 373 0
Báo cáo khoa học: Functional characterization of hepatocyte nuclear factor-4a dimerization interface mutants pot

Báo cáo khoa học: Functional characterization of hepatocyte nuclear factor-4a dimerization interface mutants pot

... 5¢-CAGGCTCAC CAGCACCTGTGACC-3¢ D312N for 5¢-AGCCTGGAG AATTACATCAACGAC-3¢ D312N rev 5¢-GTCGTTGATGTA ATTCTCCAGGCT-3¢ R324L for 5¢-CTCTCGGGGT CTTTTTGGAGAGCT-3¢ R324L rev 5¢-AGCTCTCCAAA AAGACCCCGAGAG-3¢ Q336L ... 5¢-CCCACTCTG CTGAGCATTACCTG-3¢ Q336L rev 5¢-CAGGTAATGCT CAGCAGAGTGGG-3¢ HNF-N 5¢-GATATC AAGCTTGCCGCCGCCATGGAC ATGGCTGACTACAGTGCT-3¢ HNF-C 5¢-TCTAGA GGATCCCTAGATGGCTTCC TGCTTGGTGAT-3¢ E....

Ngày tải lên: 23/03/2014, 10:21

11 400 0
Báo cáo khoa học: Functional characterization of Drosophila melanogaster PERK eukaryotic initiation factor 2a (eIF2a) kinase pdf

Báo cáo khoa học: Functional characterization of Drosophila melanogaster PERK eukaryotic initiation factor 2a (eIF2a) kinase pdf

... preliminary work in the database search and thank Ignacio V. Sandoval and Vassiliki Lalioti for their assistance with subcellular fractionation analyses. We are grateful to Encarnacio ´ nMartı ´ nez-Salas ... Wernli, B., Franklin, R.M. & Kappes, B. (1997) Molecular cloning, characterization and localization of PfPK4, an eIF 2a kinase-related enzyme from the malarial parasite Pl...

Ngày tải lên: 31/03/2014, 07:20

14 296 0
Báo cáo khoa học: Functional characterization of the maltose ATP-binding-cassette transporter of Salmonella typhimurium by means of monoclonal antibodies directed against the MalK subunit pot

Báo cáo khoa học: Functional characterization of the maltose ATP-binding-cassette transporter of Salmonella typhimurium by means of monoclonal antibodies directed against the MalK subunit pot

... same site but at the bottom part of the C-terminal domain. The only moderate effect of MalT on binding of 2F9 argues against these residues being part of the MalT–MalK interaction face. Rather, the epitope ... the a nity of the mAbs for soluble MalK, indicating a confor- mational change that renders the epitopes less accessible. 4H12 and 5B5 inhibit the ATPase a...

Ngày tải lên: 31/03/2014, 09:20

12 363 0
Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

... with PhK5 and PhK13. In all runs the same concentration of Ca 2+ ⁄ CaM was used and a 1 : 1 molar ratio of peptide was added. The inset shows a Tris ⁄ tricine SDS ⁄ PAGE gel analysis of the peak fractions from ... to allow a better understanding of the hydrodynamic behaviour of Ca 2+ ⁄ CaM and Ca 2+ ⁄ CaM ⁄ PhK5. HSQC spectra were taken after a series of increasi...

Ngày tải lên: 19/02/2014, 17:20

12 591 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... bacterium make the under- standing of its pathogenic mechanisms an urgent challenge [9,10]. S. aureus produces a variety of cell surface-associated and extracellular factors that enable bacteria to ... FEBS Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB. Analysis of mAbs binding to the re...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
w