Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

... threshold (Fig. 2) and by assuming that a CaM binding domain has to have a length of at least around 15 residues. For quantitative estimates of the binding of CaM and CaM mutants to peptides and fusion ... assumed. Abbreviations apoCaM, Apocalmodulin; BD, binding domain; CaM, calmodulin; EAG, ether a ` go-go; FCS, fluorescence correlation spectroscopy; hC...

Ngày tải lên: 07/03/2014, 12:20

... Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen Antonietta R. Farina 1 , Antonella Tacconelli 1 , Lucia Cappabianca 1 , ... and ex 60%), the Ministry of Health, MURST-CNR ÔBiomolecole per la Salute UmanaÕ Program and Associazione Italiana per la Lotta al Neuroblastoma and Progetto Speciale Ministe...

Ngày tải lên: 31/03/2014, 09:20

... infection, as assessed by the mitochondrial release of cytochrome c, caspase-9 and caspase-3 activa- tion, and DNA fragmentation. In an in vitro assay, intact ETA induced ADP-ribosylation of EF-2 and ... Quantitative analysis of DNA fragmenta- tion after toxin-induced cell death was analyzed by immu- noassay determination of cytoplasmic histone-associated DNA fragments, ac...

Ngày tải lên: 18/02/2014, 04:20

... that acarbose acts mainly by inhibiting human pancreatic a- amylase (HPA) and the breakdown of starch, and possibly other intestinal glucosidases but not MGA. The synthetic analogues of salacinol ... [33]. However the method of action of acarbose is quite complex and it appears to be acting as a type of sui- cide inhibitor of a- amylase in a mechanism where...

Ngày tải lên: 07/03/2014, 12:20

... using the Protein Assay kit based on the method of Bradford [44]. Standards and sam- ples were assayed in triplicate, according to the manufac- turer’s instructions. Sample absorbances were read against a ... occurring at the binding site, and to develop a tool that could assist further optimization of inhibitors, a molecular model of the methyltetra- hydrofola...

Ngày tải lên: 19/02/2014, 05:20

... (C-LytA) of the major autolysin of S. pneumoniae. Two of these compounds (atropine and ipratropium) display a higher binding af n- ity to C-LytA than choline, and also increase the stability of the ... NaCl and the cor- responding amount of ligand. Samples containing ligands were allowed to equilibrate for at least 10 min prior to application. Chromatography...

Ngày tải lên: 19/02/2014, 05:20

... cells and a primer set of the forward pri- mer DN-5R and the reverse primer DN+854X (sequences 5¢-CG GAATTCTCAGGATGAGGGGCATGAAG-3¢ and 5¢-CG CTCGAGGCTGCTCACTTCAGCATCAC-3¢, res- pectively) and directionally ... Kominato Y, Yamamoto F & Takizawa H (2002) Characterization of the human ABO gene pro- moter in erythroid cell lineage. Vox Sang 82, 39–46. 34 Yasuda T, Awazu...

Ngày tải lên: 19/02/2014, 06:20

... then analysed by native PAGE. Isolation and purification of the scrambled disulfide isomers of HPI In the presence of denaturant and thiol catalyst as indicated above, HPI was converted into the ... discussion. We are grateful to K. Brazine at the Dana-Farber Cancer Institute for critical reading of this manuscript. This work was supported by the grants from the Na...

Ngày tải lên: 19/02/2014, 12:20

... the mature Fd was amplified by PCR u sing as primers the oligonucle- otides Fdup 5 ¢-GCAACACCATGGCTTCTTACAAAG TGAAA-3¢ and Fdlw 5¢-CCACAAGCTTGATATCATA TCATAGCATAGCAGT-3¢ and the full length p ea ... 1 (TTGGTTCCGCGTGGATCCCGAGCT) and 2 (AGTT CCAGTTCCCAACATGATGATGACAGTAGC) at the SacI s ite of plasmid pGF105 [30]. The insertion generates a fusion protein GST-FNR+ containing...

Ngày tải lên: 19/02/2014, 16:20

... sing H 2 O 2 . The role of radical vs. nonradical processes has been investigated, as has the prevention of such damage. MATERIALS AND METHODS Amino acids, peptides and antioxidants were commercial samples ... peroxides a re also Table 1. Inhibition of glutathione reductase by H 2 O 2 and N-Ac-Trp-OMe peroxides, and lactate dehydrogenase by H 2 O 2 , in the presenc...

Ngày tải lên: 21/02/2014, 03:20