Báo cáo khoa học: A ribonuclease zymogen activated by the NS3 protease of the hepatitis C virus potx
Báo cáo khoa học: A ribonuclease zymogen activated by the NS3 protease of the hepatitis C virus potx
... to activate an RNase A zymogen. By comparing the ribonucleolytic activity and RI affinity of unactivated and activated 1C zymogen with those of other RNase A variants, we can estimate the therapeutic ... as K4 1A ⁄ G88R RNase A [43,44]. Upon activation, the Table 2. Physicochemical properties of a ribonuclease A zymogen. Ribonuclease (T m ) unactivated a (...
Ngày tải lên: 07/03/2014, 11:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... stimulate Las17p-dependent activation of the Arp2 ⁄ 3 complex. De novo actin filament assembly is critical for actin-patch formation at polarized cortical sites [29]. Because cortical actin patches are ... was a gift from J. Kahana and P. Silver (Dana Farber Cancer Center, Boston, MA). The anti-actin mAb was MAB1501 from Chemicon International (Teme- cula, CA). The anti-hexokinase ra...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
... speech recognition to increase the performance of a speech translation system. This paper proposes a method for correcting errors using the statistical features of character co-occurrence, and ... method also obtains reliably recognized partial segments of an utterance by cooperatively using both grammatical and n-gram based statistical language constraints, and uses a...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx
... 5315–5322. 4 Tanaka H, Tapscott SJ, Trask BJ & Yao M -C (2002) Short inverted repeats initiate gene amplification through the formation of a large DNA palindrome in mammalian cells. Proc Natl Acad Sci ... regulated by the combination of a weak 5¢ splice site and an adjacent intronic stem-loop cis element. J Biol Chem 280, 32700–32711. 26 Baraniak AP, Lasda EL, Wagner EJ &...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢, which introduced a NotI restriction ... BamHI5.4kb as the template with sense primer 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGCCAACTT-3¢,which introduced a NotI site (underl...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
... natural language acquisition. 2 The Language Domain Database The focus of the language domain database, (hereafter LDD), is to make readily available the different word order patterns that children ... The TLA variants do not have this capacity because they rely only on a can-parse/can’t-parse outcome and do not have access to the on-line operations of the parser. O...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... circulans 8 Bacci8 P30920 [73] Bacillus circulans 251 Bacci251 P43379 [39] Bacillus circulans A1 1 BacciA Q9F5W3 Unpublished Bacillus clarkii Baccl AB082929* [75] Bacillus licheniformis Bacli ... Slovak Academy of Sciences, Bratislava, Slovakia; 2 Department of Chemistry, Carlsberg Laboratory, Copenhagen Valby, Denmark; 3 Department of Chemistry, University of Manitoba, Winnipeg, Can...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf
... were as follows: b-actin sense, 5¢-AG AAAATCTGGCACCACACC-3¢; antisense, 5¢-GGGGTG TTGAAGGTCTCAAA-3¢; preprohepcidin sense, 5¢-CAG CTGGATGCCCATGTT-3¢; antisense, 5¢-TGCAGCACAT CCCACACT-3¢; A1 AT ... with a- 1 antitrypsin deficiency may be the reason for the disturbance in their iron homeostasis. Abbreviations A1 AT, a- 1 antitrypsin; AA, amino acid; CTCK, carbenicillin–tetracycline–chlo...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx
... (5¢-GCCCAAGGTGAACT TTTCAA-3¢) and TMV2 (5¢-TAGCGCAATGGCATACA CTC-3¢). The sequence of as-DNA is 5¢-CAATACTGTCT TTCTGGCCTTC-3¢, and that of s-DNA is 5¢-ATAGGCG GGAATTTTGCATC-3¢. Anti-TMV siRNA was synthe- sized ... using the DNA templates 5¢-AAGGGACGAGCA TATGTACACCCTGTCTC-3¢ and 5¢-AAGTGTACATAT GCTCGTCCCCCTGTCTC-3¢ and a Silencer siRNA Con- struction Kit (Ambion, Austin, TX, USA). T...
Ngày tải lên: 16/03/2014, 02:20