Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

... by means of mathematical models with varying degrees of detail. A primary advantage of a detailed, biochemically formulated model is that a one-to-one comparison can be made between model and ... Journal compilation ª 2006 FEBS models are evaluated by calculating the eigenvalues of the Jacobian matrix at a particular stationary state, common to all models. In this case,...

Ngày tải lên: 07/03/2014, 11:20

16 492 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... dusan.turk@ijs.si Database The coordinates and structure factors are available in the Protein Data Bank database under accession number 3K9M (Received 14 June 2010, revised 11 August 2010, accepted 16 August ... molecule A of stefin A; and M1 and E78 in the molecule B of stefin A. Additionally, eleven side chains lack adequate electron density. The r.m.s.d. between all pairs of super...

Ngày tải lên: 18/02/2014, 04:20

8 633 0
Báo cáo khoa học: Submembraneous microtubule cytoskeleton: biochemical and functional interplay of TRP channels with the cytoskeleton pot

Báo cáo khoa học: Submembraneous microtubule cytoskeleton: biochemical and functional interplay of TRP channels with the cytoskeleton pot

... Shinoda M, Nagamine K, Tohnai I, Ueda M & Sugiura Y (2005) Heat and mechanical hyperalgesia in mice model of cancer pain. Pain 117, 19–29. 141 Prevarskaya N, Flourakis M, Bidaux G, Thebault ... cultures: role of calpain and caspase pathways. Cell Death Differ 11, 1121–1132. 154 Razavi R, Chan Y, A fiyan FN, Liu XJ, Wan X, Yantha J, Tsui H, Tang L, Tsai S, Santamaria P et al. (2006)...

Ngày tải lên: 30/03/2014, 10:20

16 303 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan ... fw, forward; rev, reverse. Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD rea...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... did not affect the patient but, in these cases, nurses administered medication without a legally valid physi- cian order. Although an absent 'signature' with CPOE was regarded as an error, ... harm or an increase in patient monitoring with no change in vital signs and no harm noted. Moderate errors were classified as those causing an increase in patient monitoring, a change...

Ngày tải lên: 25/10/2012, 10:39

6 526 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... 228–238. 24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar MJ, Anazawa H, Harms N, Oltmann LF & Stouthamer AH (1991) A method for introduction of unmarked mutations in the genome of Paracoccus ... struc- ture of Saccharomyces cerevisiae Met8p, a bifunctional dehydrogenase and ferrochelatase. EMBO J 21, 2068– 2075. 18 Bandi S, Baddam S & Bowler BE (2007) Alkaline con- forma...

Ngày tải lên: 15/02/2014, 01:20

12 614 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into ... suggest that mammalian Gup1 acts as a negative regulator of the N-terminal palmitoylation of Shh. Discussion In this report, we found that mammalian Gup1, a mem- ber of the MBOAT super...

Ngày tải lên: 18/02/2014, 16:20

14 500 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... to a value of 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at 2 mm phosphate. At Table 1. Effects of ... by a cou- pled enzyme assay [14] and the change in absorbance at 340 nm as a result of NADH consumption was monitored with a Dynatech MR5000 microplate reader with biolynx data...

Ngày tải lên: 19/02/2014, 16:20

9 579 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC 2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of ... 7.0) at a concentration of 0.5 mgÆmL )1 . Spec- tra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 nmÆmin )...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... Proteobacteria, Betaproteobacteria 2 1 Klebsiella pneumoniae Kp342 Proteobacteria, Gammaproteobacteria 1 1 Salmonella enterica ssp. I choloraesuis Proteobacteria, Gammaproteobacteria 0 2 Chromohalobacter ... 2 Chromohalobacter salexigens DSM3034 Proteobacteria, Gammaproteobacteria 1 1 Acinetobacter sp. (strain ADP1) Proteobacteria, Gammaproteobacteria 1 1 Pseudomonas fluorescens Pf5 ATCC BAA-4...

Ngày tải lên: 07/03/2014, 00:20

13 390 0
Từ khóa:
w