0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

... by means of mathematicalmodels with varying degrees of detail. A primaryadvantage of a detailed, biochemically formulated model is that a one-to-one comparison can be madebetween model and ... Journal compilation ª 2006 FEBSmodels are evaluated by calculating the eigenvalues of the Jacobian matrix at a particular stationary state,common to all models. In this case, the basic dynamic property ... biochemistry. A major disadvan-tage of such a full-scale model stems from its largenumber of parameters. A large number of parameters,compared with the information available from experi-ments, makes...
  • 16
  • 492
  • 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... dusan.turk@ijs.siDatabaseThe coordinates and structure factors areavailable in the Protein Data Bank databaseunder accession number 3K9M(Received 14 June 2010, revised 11 August2010, accepted 16 August ... molecule A of stefin A; and M1 and E78 in the molecule B of stefin A. Additionally, eleven side chains lack adequate electrondensity. The r.m.s.d. between all pairs of superimposedCA atoms of cathepsin ... symmetry, with anacceptable Rmerge of 0.132 and data completeness of 96.7%.The structure was determined by molecular replacementusing amore [40] with cathepsin B [13] and stefin A [28] assearch models....
  • 8
  • 632
  • 0
Báo cáo khoa học: Submembraneous microtubule cytoskeleton: biochemical and functional interplay of TRP channels with the cytoskeleton pot

Báo cáo khoa học: Submembraneous microtubule cytoskeleton: biochemical and functional interplay of TRP channels with the cytoskeleton pot

... Shinoda M, Nagamine K, Tohnai I,Ueda M & Sugiura Y (2005) Heat and mechanicalhyperalgesia in mice model of cancer pain. Pain 117,19–29.141 Prevarskaya N, Flourakis M, Bidaux G, Thebault ... cultures: role of calpain and caspasepathways. Cell Death Differ 11, 1121–1132.154 Razavi R, Chan Y, A fiyan FN, Liu XJ, Wan X,Yantha J, Tsui H, Tang L, Tsai S, Santamaria P et al.(2006) TRPV1+ ... Ferna´ndez-Carvajal A, Morenilla-PalaoC, Planells-Cases R, Fajardo-Sa´nchez E, Ferna´ndez-Ballester G & Ferrer-Montiel A (2004) Identification of a tetramerization domain in the C-terminus of...
  • 16
  • 303
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan ... fw, forward; rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time ... Ala wascarried out using the QuickChange kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢...
  • 14
  • 601
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... did not affect the patient but, in these cases,nurses administered medication without a legally valid physi-cian order. Although an absent 'signature' with CPOE wasregarded as an error, ... harm or an increase in patient monitoring with nochange in vital signs and no harm noted. Moderate errors wereclassified as those causing an increase in patient monitoring, a change in vital ... estimates that between 44,000 and 98,000 Ameri-cans die as a result of medical errors each year, with the major-ity of these errors being preventable [18]. MEs are the leadingtype of medical...
  • 6
  • 526
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & StouthamerAH (1991) A method for introduction of unmarkedmutations in the genome of Paracoccus ... struc-ture of Saccharomyces cerevisiae Met8p, a bifunctionaldehydrogenase and ferrochelatase. EMBO J 21, 2068–2075.18 Bandi S, Baddam S & Bowler BE (2007) Alkaline con-formational transition and ... d1heme lacking iron and ⁄ or with the side chain satu-rated, but accessing these putative substrates is nottrivial. An alternative approach would be to seek accu-mulation of the substrate of NirF...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into ... suggestthat mammalian Gup1 acts as a negative regulator of the N-terminal palmitoylation of Shh.DiscussionIn this report, we found that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing ... simi-larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports havedemonstrated the critical role of N-terminal palmitoyla-tion of Hh protein for its activity...
  • 14
  • 499
  • 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... to a value of 7.3 dramatically altered the effect of phosphate andactivation was seen only at low concentrations with a maximal 1.7-fold activation at 2 mm phosphate. AtTable 1. Effects of ... by a cou-pled enzyme assay [14] and the change in absorbance at340 nm as a result of NADH consumption was monitored with a Dynatech MR5000 microplate reader with biolynxdata capture software. ... concentration of Mg.ATP was heldat 0.5 mM. All other assay conditions are detailed in the Materials and methods. Data are means ± SEM, n ¼ 4 separate determinations.Temperature Phosphate (mM)...
  • 9
  • 579
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of Minnesota College of ... 7.0) at a concentration of 0.5 mgÆmL)1. Spec-tra were obtained as the average of five successivescans with a bandwidth of 1.0 nm and a scan speed of 20 nmÆmin)1.Steady-state tryptophan fluorescencemeasurementsMeasurements ... reportedthat multiple mutations can cause large changes in theaverage conformation of denatured proteins. Here weshow that a specific single mutation or removal of a specific fragment can cause large...
  • 7
  • 551
  • 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... Proteobacteria, Betaproteobacteria 2 1Klebsiella pneumoniae Kp342 Proteobacteria, Gammaproteobacteria 1 1Salmonella enterica ssp. I choloraesuis Proteobacteria, Gammaproteobacteria 0 2Chromohalobacter ... 2Chromohalobacter salexigens DSM3034 Proteobacteria, Gammaproteobacteria 1 1Acinetobacter sp. (strain ADP1) Proteobacteria, Gammaproteobacteria 1 1Pseudomonas fluorescens Pf5 ATCC BAA-477 Proteobacteria, ... SKA53 Proteobacteria, Alphaproteobacteria 2 0Roseovarius sp. HTCC2601 Proteobacteria, Alphaproteobacteria 2 0Ralstonia eutropha H16 Proteobacteria, Betaproteobacteria 2 1Comamonas testeroni...
  • 13
  • 390
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ