Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... enzyme as well. These findings support the concept that the hinge region of PKG acts as a stability switch. Abbreviations MEW, maximal emission wavelength; PKA, cAMP-dependent protein kinase; PKG, cGMP-dependent ... by cGMP binding is thought to induce the release of the auto- inhibitory domain from the active site, thereby activa- ting the kinase. This is indic...

Ngày tải lên: 07/03/2014, 09:20

... A role of the cytoplasmic tail of membrane-spanning proteins in protein protein interactions has also been proved, e.g. the case of the association between the N-terminal region of the membrane-bound ... regulated intramembrane proteolysis, can be released into the cytosol as a signaling fragment. The intracellular region of Jagged-1 may then exist in at least tw...

Ngày tải lên: 18/02/2014, 16:20

... if an abnormality was present, whether it was judged to be an 'old' or 'new' finding). In case an abnormality was worsening, and fulfilling the criteria as in table 1, it was categorized ... At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands [13]. There may be advantages to eliminating daily routine CXRs...

Ngày tải lên: 25/10/2012, 10:39

... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ... determination of the phytase gene Strain HJB17 was cultured in Luria–Bertani medium at 37 °C overnight and genomic DNA was extracted using the TIANamp Bacteria DNA kit (Tiange...

Ngày tải lên: 14/02/2014, 15:20

... an activating element binding E2F1, -2 and -3. These acti- vating E2Fs cooperate with NF-Y proteins binding to CCAAT-boxes and with Myb proteins associating with a distal Myb site in activating the Cdc2 promoter. Binding ... Caenor- habditis elegans synMuvB proteins and is composed of p130, E2F4 ⁄ 5 and DP1 ⁄ 2 and a module containing the MuvB proteins Lin-37, Lin-52, Lin-54 and chr...

Ngày tải lên: 16/02/2014, 09:20

... participates in picolinic acid (PA), quinolinic acid (QA) and NAD homeostasis. Indeed, the enzyme stands at a branch point of the tryptophan to NAD pathway, and deter- mines the final fate of the amino acid, ... by the action of ACMS decarboxylase (ACMSD, also known as picoli- nate carboxylase; EC 4.1.1.45) into a- aminomuconic Keywords cerebral malaria; kynurenine pathway; me...

Ngày tải lên: 18/02/2014, 06:20

... with aA- and aB-crystallin declines. The altered interplay with other crystallins illustrates that R116C aA-crystallin and R120G aB-crystallin, both observed in congenital cata- ract, maintain ... elements and molecular chaperones. As a- crystallin chapero- ning capability declines, lens proteins are more likely to aggregate, a characteristic linking cataract to other protein foldi...

Ngày tải lên: 19/02/2014, 18:20

... following standards: ferritin (440 kDa), catalase (232 kDa), aldolase (158 kDa), ovalbumin (43 kDa), and chymotrypsinogen (25 kDa). Peptide mass finger-printing was performed after trypsin digestion ... similar to the one in Eubacterium acidaminophilum containing tupA are also found in Vibrio cholerae, Campylobacter jejuni, Haloferax volcanii and Methanothermobacter thermautotrophicus, a...

Ngày tải lên: 20/02/2014, 23:20

... S-transferase; LPA, lysophosphatidic acid; MAP, microtubule-associated protein; MAPK, mitogen-activated protein kinase; MBP, maltose-binding protein; PH, Pleckstrin homology domain. FEBS Journal ... that RasGRF1 binds IB2 ⁄ JIP2 [33], a scaffold protein for the Jun N-ter- minal kinase signaling pathway. JIP proteins also link the motor proteins kinesins with the cargo comple...

Ngày tải lên: 07/03/2014, 12:20

... [13]. Site-2 and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay. The DNA affinity column, used as the last step in the purification, was prepared with an ... wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA TGGTAAT...

Ngày tải lên: 07/03/2014, 15:20