Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... (5¢-to3¢) Vps4 DEL F TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT Vps4 DEL R ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA Vps4 TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA Vps4 TRP R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4 RDF ... meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain. The distinguishing feature of members o...

Ngày tải lên: 07/03/2014, 05:20

... coenzyme analog lacking the ade- nine ring in the upper axial ligand; a model of damaged cofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing the adenine ring ... 11 A ˚ in height. The size of this cavity is comparable with that of adenine- lacking cobalamins, and thus allows the damaged cofactor to pass through it. Intac...

Ngày tải lên: 15/02/2014, 01:20

... in the vicinity of the steady state. We do this to investigate the stability of this state. In this way we obtain the in uence a small change in the concentration of substance j, i.e. Dx j ,hasonthetime displacement ... (IMC, VUA) and Mathematical Biochemistry (SILS, UvA), Amsterdam, the Netherlands; 3 Department of Biochemistry and Molecular Biology, Faculty...

Ngày tải lên: 19/02/2014, 16:20

... domain interactions in presence and absence of cGMP. The interaction of the auto-inhibi- tory domain with the catalytic domain in the presence and absence of cGMP is of particular interest, as it forms ... release of the auto- inhibitory domain from the active site, thereby activa- ting the kinase. This is indicated by a remarkable increase in the pro...

Ngày tải lên: 07/03/2014, 09:20

... acquire alternating verbs from large balanced corpora by using partial- parsing methods and taxonomic information, and discuss how corpus data can be used to quantify lin- guistic generalizations. ... in the benefactive alternation if it has the double object and 'V NP1 for NP2' frames. Ta- ble 5 shows a comparison of the verbs found in the corpus ag...

Ngày tải lên: 20/02/2014, 19:20

... primer pairs and TaqMan MGB probes used for inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, ... TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al. 680 FEBS Journal 276 (2009...

Ngày tải lên: 07/03/2014, 03:20

... T m values obtained by the two state interpretation of the CD data. These values of T m appear to fall near the minima of the / angle curves. For comparison we also studied the variant peptide Ab(12–28)G19G20. ... shorter fragments, Ab(1–9) and Ab(12–28) at varying tempera- tures at 500 lm concentration and pH 7. Assignment was based on standard procedures. The aim was...

Ngày tải lên: 20/02/2014, 01:20

... statistical analysis of the study. MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript revi- sion. All authors read and approved the final ... obtained on a daily basis, at least in The Netherlands [13]. There may be advantages to eliminating daily routine CXRs. First, a routine strategy carries the risk th...

Ngày tải lên: 25/10/2012, 10:39

... was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 min when assayed at 35 °C (Fig. 3A, B). The presence of Ca 2+ increased the thermal stability of PhyH and ... they can increase the amount of available phosphate by interacting together. Additionally, fusing PhyH-DI to a single-domain phytase appears to be an efficient way to impr...

Ngày tải lên: 14/02/2014, 15:20

... Yasuda T (2002) Activation of AtMEK1, an Ara- bidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed in E. coli and generation of the active form ... [c- 32 P]-ATP. MBP was used as an artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kinas...

Ngày tải lên: 14/02/2014, 19:20