Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

... c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis Dan Sato 1, *, Wataru Yamagata 2 , ... catalyzes the a, c-elimination and c-replacement of l-Met and homocysteine (Hcy), and a, b-elimination and b-replacement of l-Cys an...

Ngày tải lên: 07/03/2014, 05:20

13 406 0
Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

... m M Mes (pH 7) and substrate (5¢-G 2 CCCUCUAAAAA-3¢)at50°C [6]. c Substrate-cleavage reaction (exogenous guanosine-mediated) of the substrate (5¢-CUUAAAAA-3¢) using the Anabaena ribozyme (L-8 ... 1) [14,17,21]. Dependence of substrate cleavage on pH It has been reported that the rate of the substrate- cleavage step in Tetrahymena [22–25], Anabaena [14] and Azoarcus [17] grou...

Ngày tải lên: 18/02/2014, 18:20

13 761 0
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

... properties and subcellular localization patterns of the enzyme. USP7 is phosphorylated at S18 and S963, and ubiquitinated at K869 in mammalian cells. In in vitro activity assays, N- and C-terminal truncations affected ... M1 and E20, an alpha helix from there and up to amino acid G28, followed by a b-sheet starting at T36 and extend- ing to residue L49, and a larger...

Ngày tải lên: 07/03/2014, 05:20

15 593 0
Tài liệu Báo cáo khoa học: "Automatic Collection of Related Terms from the Web" pptx

Tài liệu Báo cáo khoa học: "Automatic Collection of Related Terms from the Web" pptx

... transla- tion. The target application of the method is auto- matic or semi-automatic compilation of a glossary or technical-term dictionary for a certain domain. Re- cursive application of the ... Automatic Collection of Related Terms from the Web Satoshi Sato and Yasuhiro Sasaki Graduate School of Informatics Kyoto University Sakyo, Kyoto, 606-8501 Japan sato@i.kyot...

Ngày tải lên: 20/02/2014, 16:20

4 437 0
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

... observe the appearance of two peaks at 1618 and 1683 cm )1 , which are typical of the formation of an intermolecular antiparallel b-sheet aggregate [21]. The thermal stability of b-glucosidase was assessed by ... acid and the DNA level, respec- tively; they also have a similar catalytic mechanism and substrate specificity. However, the molecular basis of the high...

Ngày tải lên: 07/03/2014, 03:20

9 341 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 (1) Protein containing DNAJ domai...

Ngày tải lên: 18/02/2014, 06:20

15 586 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed ... Wellenreuther and W. Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the...

Ngày tải lên: 18/02/2014, 06:20

15 624 0
Tài liệu Báo cáo khoa học: Kinetic analysis of effector modulation of butyrylcholinesterase-catalysed hydrolysis of acetanilides and homologous esters pdf

Tài liệu Báo cáo khoa học: Kinetic analysis of effector modulation of butyrylcholinesterase-catalysed hydrolysis of acetanilides and homologous esters pdf

... 7.0 at 25 °C. The effect of each ligand on related pairs of substrates (neutral substrates o-NAC and o-NPA, and positively charged substrates ATMA and ASCh) was compared. To avoid complications ... analysis of BuChE AAA activity was carried out with a positively charged acetanilide (ATMA), a negatively charged acetanilide (NATAc) and neutral acetanilides (o-NAC and...

Ngày tải lên: 18/02/2014, 17:20

15 544 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The ... estimated directly from the values of absorbance at these maxima (data not shown). The estimated association constants for imi- dazole and azide binding to heme–GmHO-1 are s...

Ngày tải lên: 19/02/2014, 05:20

16 618 0
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

... DASA polar are the changes in ASA of the apolar and polar residues, respectively [39]. The structure-based calculations provide a DC p of )407 calÆmol )1 ÆK )1 and DASA apolar and DASA polar of )1354 and ... and without the receptor N-domain using the vadar program [41]. The DC p was calculated using the following equa- tion: DC p ¼ 0:45DASA apolar À 0:26 ASA p...

Ngày tải lên: 19/02/2014, 05:20

11 549 0
w