Báo cáo khoa học: Recombinant bovine zona pellucida glycoproteins ZP3 and ZP4 coexpressed in Sf9 cells form a sperm-binding active hetero-complex ppt

... (lane 2 in each panel). The rZP3 and rZP3 FLAG bands are indicated by arrowheads in (A) , (B), and (C). The rZP4 band is indi- cated by an arrow in (A) and (B). The ZP4 182)464 band is indicated by ... (C). Arrowheads indicate the recombinant protein bands. Molecular mass markers are indicated in kDa on the left of each panel. S. Kanai et al. Recombinant bovine zona p...

Ngày tải lên: 07/03/2014, 05:20

... metabolism, and on studying DNA damage. The metabolism of glutathione and DNA breaks were investigated in hepatocellular carcinoma HepG2 cells cultivated with or without pyruvate during and after ... effects against hypoxia and reoxygenation. This is mainly ascribed to its ability to maintain redox status [17], intervening in the DNA repair system [18–20] and restoring antioxi...

Ngày tải lên: 18/02/2014, 16:20

... Consolidated Research Institute for Advanced Science and Medical Care, Waseda Univer- sity. References 1 Shinohara A, Ogawa H & Ogawa T (1992) Rad51 pro- tein involved in repair and recombination ... Enomoto R, Tanaka K, Miyagawa K, Shibata T, Kurumizaka H & Yokoyama S (2004) Structural basis for octameric ring formation and DNA interaction of the human homologous-pairing pro...

Ngày tải lên: 19/02/2014, 06:20

... output using the features generated by ALMORGEANA, the training data must also be in the ALMORGEANA output format. To obtain this data, we needed to match data in the ATB to the lexeme -and- feature ... data prepara- tion. We use the ALMORGEANA morphological ana- lyzer (Habash, 2005), a lexeme-based morphologi- cal generator and analyzer for Arabic. 5 A sample output of the morpholo...

Ngày tải lên: 20/02/2014, 15:20

... Smad4-dependent. PC12 cells were transfected with Smad3, Smad4 or a functionally inactive Smad4 variant – Smad4(DSAD) – either alone or in the indicated combinations. Smad4(DSAD) lacks amino acids 274–321 ... functional TrkA receptors and can be impaired by the inhibitory Smad7. Materials and methods Antibodies and reagents The monoclonal antibody against TGF-b1, -b 2and- b3 (clon...

Ngày tải lên: 16/03/2014, 16:20

... K d values for FVIIa binding to AEDANS-sTF were calculated (Table 1). These data show that the AEDANS-sTF mutants maintained virtually normal binding to FVIIa and normal cofactor activity (Table ... to examine the impact of mutation and labeling of sTF on FVIIa binding and enhancement of FVIIa activity. The ability of the IAEDANS-labeled sTF variants to stimulate FVIIa was assessed and...

Ngày tải lên: 17/03/2014, 03:20

... utilized in daily teaching. The relationship between formal and naive grammars in foreign language teaching is dealt with in this paper which presents, as a case study, an attempt to integrate ... • ~ • TEACHING THE ENGLISH TENSE: INTEGRATING NAIVE AND FORMAL GRAMMARS IN AN INTELLIGENT TUTOR FOR FOREIGN LANGUAGE TEACHING Danilo Fum 1, Bruno Pani 2 and Carlo Tasso 2 1...

Ngày tải lên: 18/03/2014, 02:20

... ACATCTGAGTCTAGATATATACGTTTGTGTAGCGGGAAACGTTAAAAAAAAAAATCTTAATTATAGTTTATCGATGAATTCGAGCTCGTTTAAAC KP1(SFH4) GCTCCACCCATCTCTATTGC KP2(SFH4) GGTCAATTTACCGTAAGT P1(SFH5) TGTCACAAATGTCCATCCAACAGAATACGGCCTTTACATTTTACAAAAACAAATCATCGAGGACGTTGAG GGAGCAGGTGCTGGTGCTG P2(SFH5) ... GGCATGTGGGTGAATTACAA R(SFH1-EGFP) GACGAGGCAAGCTAAACAGAT P1(SFH2) AAACTACTCCAAGTTAGATCCGTACATCAGATCAAGATCCGTTTATGACTACAATGGTTCT...

Ngày tải lên: 23/03/2014, 18:20

... 3) in a summarization application that aims at producing both informative and fluent headlines. Our head- lines are generated in an abstractive, bottom-up manner, starting from words and phrases. ... in a first phase, symbolic knowledge to (over)generate a large set of candidate realizations, and, in a second phase, statistical knowledge about the target language (such as s...

Ngày tải lên: 23/03/2014, 18:20

... 5¢-TGGGCGAGCTCATGAGCGACATT AAGAAATCTG-3¢ and 5¢-CGCTCAGAACGACACCG TTTG-3¢, covering 11 bp upstream of the start codon and the first 957 bp of the carB coding sequence, and 5¢- CGTTGAGGCACTGGTTAACG-3¢ and 5¢-CGAGAAT CATGGACATAGAC-3¢, ... Car- BG-2F (5¢-TGGGCGAGCTCATGAGCGACATTAAGAA ATCTG-3¢) and CarBG-3R (5¢-CGCTCAGAACGACA CCGTTTG-3¢). The presence of the carB36 mutation was checked us...

Ngày tải lên: 30/03/2014, 01:20