Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

... compilation ª 2009 FEBS Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus Pierre-Paul Prevot 1 , Alain Beschin 2,3 , Laurence Lins 4 ,Je ´ ro ˆ me ... Ixolaris, a novel recombinant tissue factor pathway inhibitor (TFPI) from the salivary gland of the tick, Ixodes scapularis: ident...

Ngày tải lên: 07/03/2014, 01:20

12 500 0
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

... USA 75, 2315–2319. 33. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S. & Kobata, A. (1984) Comparative study of the oligosaccharides released from baby hamster kidney cells and their ... that of 4 by the presence of a 2-acetamide group adjacent to the p-nitro- phenyl group. This was the same in the case of a comparison of 1 and 3. Furthermore, the enzym...

Ngày tải lên: 31/03/2014, 07:20

11 365 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... collection of the data in and of itself as the basis for taking relevant action at the farm. They may skip the process of systematic anal- ysis of data and give advice based on their immediate eval- uation ... or her evaluation of the local context. That is, treatment data as an indicator of a certain disease manifestation may only be valid within the herd. When vete...

Ngày tải lên: 25/10/2012, 10:45

10 588 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... black dots, protease cleavage sites. (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver stain ... identify the extracellular ligands of the RPTPs in the neuromuscular system. For example, it is known that PTPd and an isoform of LAR can interact homophilically [39] and that LAR ca...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt

Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt

... DpsA-Te1 (5¢-GGAGTATCGT CATATGACGACCAGTGCATTG-3¢) and DpsA-Te2 (5¢-CAGACGACACA AAGCTTCACC TTG-3¢). The NdeI and HindIII restriction sites are under- lined. The amplified fragment (530 bp) was ... between the last amino acid (valine) and the His-tag. Cleavage by factor Xa occurs after an arginine, and the preferred cleavage site is Asp (or Glu or Ile)-Gly-Arg. Factor Xa was chosen as...

Ngày tải lên: 15/03/2014, 09:20

15 293 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

... Yamagami C, Takao N, Tanaka M, Horisaka K, Asada S & Fujita T (1984) A quantitative structure–activity study of anticonvulsant phenylacetanilides. Chem Pharm Bull 32, 5003–5009. 26 Birnbaum ... enzymatic reactions (GGT-catalyzed transpeptidation, and AGA-catalyzed and PGA-catalyzed hydrolysis), acylation is the rate- limiting step [16–18]. However, the values of q for Scheme 1....

Ngày tải lên: 16/03/2014, 01:20

10 425 0
Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

... 5¢-CGCCGTCCGCGTCCAAAC GCCG CGGAAGTCATGAATATTGTAGGTAACATCGAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTCATGACT TCCGC GGCGTTTGGACGCGGACGGCG for V20 4A (pHO393), 5¢-CGTGGCG GCGGTCATGAATATTGTAGG and 5¢-CCTACAATATTCATGAC CGCCGCCACG ... for P20 2A (pHO380), 5¢-CGCCGTCCGCGTCCA GCTGTGGCGGAAGTCATGAATATTGTAGGTAACATC GAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTC ATGACTTCCGCCAC AGCTGGACGCGGACGGCG for N20 3A (pHO392...

Ngày tải lên: 23/03/2014, 15:20

9 330 0
Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf

Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf

... 5¢-CGGGATCCTCACTCCAAGGACA CGGCA-3¢;DR5forward,5¢-CGGAATTCTGCA AGTCTTTACTGTGGAA-3¢; DR5 reverse, 5¢-CGGA TCCTTAGGACATGGCAGAG-3¢;DcR2forward, 5¢-CGGAATTCCGCGGAAGAAATTCATTTCT-3¢; DcR2 reverse, 5¢-CGGGATCCTCACAGGCAGGACG TAGCAG-3¢; Bax ... and Protein Analyser (Beckman Coulter). Two micrograms of total RNA was reverse transcribed using the TaKaRa One Step RNA PCR kit (TaKaRa Bio Inc., Shiga, J...

Ngày tải lên: 23/03/2014, 17:22

11 409 0
Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt

Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt

... with an excess of GPAO (5 mg, added as a concentrated solution in the same buffer) and the mixture was incubated at 30 °C for 12 h. After that, the same amount of GPAO was added again and the ... decreased. Only a few amino acid side c hains seem to be modified as a result of the reaction. A major part of DAPY oxidation product, aminopentynal, after the conjugate ad...

Ngày tải lên: 19/02/2014, 16:20

13 604 0
Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

... from the relative increased character accuracy to the relat ive increased MAP for the three lexicon adaptation ap- proaches are different. A key factor making the proposed LAICA approach advantageous ... parts randomly: 5K as the adaptation corpus and 5K as the testing set. We show the ASR char- acter accuracy results after lexicon adaptation by the proposed approach in Ta...

Ngày tải lên: 20/02/2014, 07:20

9 466 0
w