Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

... Journal compilation ª 2009 FEBS Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold Yasuyuki Kawashima 1, *, Taku Ohki 1, *, Naoki Shibata 2,3, *, ... mutagenesis. Roles of Asn266 Superimposition of Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial positi...

Ngày tải lên: 07/03/2014, 00:20

... Bxe _A2 876 (accession number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS d...

Ngày tải lên: 18/02/2014, 06:20

... hypophos- phatasia, (c) childhood hypophosphatasia, (d) adult hypophosphatasia and (e) odonto hypophosphatasia [1–4]. Perinatal and infantile forms of hypophosphata- sia are severe and are usually transmitted ... alkaline phosphatase with missense mutations causing hypophosphatasia. Eur J Med Genet 50, 367–378. 28 Cai G, Michigami T, Yamamoto T, Yasui N, Stomura K, Yamagata M, Shima M, Na...

Ngày tải lên: 07/03/2014, 05:20

... lyase pathway). Bottom: cleavage to yield AMPA and glyoxylate (the AMPA pathway), referred to as the GOX pathway. (B) Reaction catalyzed by GO on glyphosate, an alternative to the AMPA pathway ... meth- ods of computational enzyme design are advancing to the point that de novo design of an enzyme with a par- ticular and novel catalytic function is a reasonable L. Pollegioni...

Ngày tải lên: 14/02/2014, 14:20

... phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site at the interface of the two domains [4,5]. HAPs can initi- ate ... substrate-free AppA the C a atoms are 2.41 A ˚ apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1.87 A ˚ . Distin...

Ngày tải lên: 16/02/2014, 09:20

... mitochondria with and without substrate. Proc Natl Acad Sci USA 90, 7523–7527. 17 Ikeda Y & Tanaka K (1983) Purification and character- ization of isovaleryl coenzyme A dehydrogenase from rat liver ... 529–540. 22 Shimomura Y, Honda T, Shiraki M, Murakami T, Sato J, Kobayashi H, Mawatari K, Obayashi M & Harris RA (2006) Branched-chain amino acid catabolism in exercise and liver...

Ngày tải lên: 18/02/2014, 04:20

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACAT...

Ngày tải lên: 18/02/2014, 06:20

... Pedro Alexandrino Fernandes 2 , Jose ´ A. M. Prates 3 , Carlos M. G. A. Fontes 3 , Marta Bruix 4 , Maria Joa ˜ o Roma ˜ o 1 , Ana Luı ´ sa Carvalho 1 , Maria Joa ˜ o Ramos 2 , Anjos L. Macedo 1 and ... and that all the studied polysaccharides make sev- eral hydrogen bonds with the Asp99, Arg126, Asp128 and Asp146 amino acids and, in the case of the larger ligands, with Asp51 as well....

Ngày tải lên: 18/02/2014, 17:20

... N, Kamogawa J, Yamamoto H, Takubo N, Nakata S, Yamada K, Yamamoto S et al. (2005) Accumulation of plasma cells expressing CXCR3 in the synovial sublin- ing regions of early rheumatoid arthritis in association with ... significantly elevated in RA synovial fluid compared with synovial fluid from patients with OA or other forms of arthritis. The syno- vial fluid and peripheral blood...

Ngày tải lên: 18/02/2014, 18:20

... mononu- clear cells, synovial fluid and saliva from RA patients than from controls and patients with other arthritides [16]. An EBV DNA quantification assay using real-time PCR revealed that the EBV DNA ... Shibata S, Munakata Y, Ishii T, Ishii K, Saitoh T, Sawai T, Sugamura K & Sasaki T (1998) Human parvovirus B19 as a causative agent for rheumatoid arthritis. Proc Natl Acad Sci U...

Ngày tải lên: 18/02/2014, 18:20