Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... to the single canonical EF-hand, there is a ‘hidden’, atypical, non-Ca 2+ -binding EF-hand motif that stabilizes the intramolecular inter- action between the canonical EF-hand and the SAM domain. ... A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca 2+ Yun Huang, Yubin Zhou, Hing-Cheung Wong, Yanyi Chen, Yan Chen...
Ngày tải lên: 07/03/2014, 00:20
... protein, the cDNA encoding p16 was obtained from the psp54 (28) cDNA. The oligonucleotides used as primers were: 5¢-CCCCTCGA GATGTCTAGACAAAAAAAGAGTAG-3¢ and 5¢-CCC CTCGAGTCACACAACAGCACGAC-3¢.ThePCR product ... N-terminal tails are involved in protein binding. They are accessible both in the nucleosome [2] and in chromatin [17] and they are the site of post-translatio...
Ngày tải lên: 08/03/2014, 10:20
... thrombin slowly and continuously dissociated from the immobilized TM at the same rate as in the absence of PAI-1 and no increase in surface-bound mass was observed as a result of PAI-1 binding ... Poly- sorbate-20 (Surfactant P20), and all additional BIAcore materials were obtained from BIAcore AB (Uppsala, Sweden). Proteins Ovalbumin (grade V) was obtained from...
Ngày tải lên: 23/03/2014, 17:21
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... quadrivirgata , E. climacophora and A. blomhoffii DNases I Total RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method [24] and any DNA contamination was ... generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essen...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline). Name Size (nt) Sequence CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC AT...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... of the psbA mRNA is not affected in the mf2 strain The dramatic decrease in D1 synthesis in mf1 and mf2 strains did not correlate with any significant changes in the accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢,andtheEcoRI restriction fragment of the chloroplast genome R14 [16] as a te...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx
... velocity measurements in the presence of NADPH as the electron donor and 2-hydroxy-p-naphthoquinone as electron acceptor. The family of parallel lines obtained from data analysis indicates a ping-pong ... states of the different variants in the crystalline state were analyzed using the msd-pisa server [20] taking into account all the interactions of protein c...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
... the malE-malF substrate at 37 °C in the presence or in the absence of EDTA. As shown in Fig. 6A, incubation of the wild-type protein with the RNA sub- strate in the absence of EDTA resulted in ... important information in the knowledge of RNase II proteins. To date, there are no structural or mutational data available from any other proteins of th...
Ngày tải lên: 30/03/2014, 15:20
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt
... to clone the MABO gene. The DNA fragment carrying the MABO ORF was amplified with the primer pair 5¢-GAC CTGAGTAGAAATGGATCCCTGA TGGACAGG-3¢ and 5¢-GGAATGGCTCGAGGGATCATCACC-3¢ bear- ing the restriction ... role in the biodegradation of a n a lmost unlimited spectrum of natural and man-made organic compounds, among them the tobacco alkaloid nicotine. Perhaps analysed...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt
... viewpoint and integrated various tasks such as POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model. Feature-based methods (Kambhatla, ... takes about 110 minutes and 30 minutes to do training on the ACE 2003 (~77k training in- stances) and 2004 (~33k training instances) data, respectively. (2) Further Improvemen...
Ngày tải lên: 20/02/2014, 12:20