CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot
... often called for was that of the Madonna and Child. Madonna is the word, meaning literally My Lady, used by the Italians when speaking of Mary, the mother of Jesus. The Madonna and Child is then ... DECORATION IN THE SALA DEL PERGOLATO (HALL OF THE VINE TRELLIS) (S. Paolo, Parma) In the time of Correggio the convent of S. Paolo (St. Paul) in Parma was...
Ngày tải lên: 06/03/2014, 13:20
... discover. Marks, notations and other marginalia present in the original volume will appear in this file - a reminder of this book’s long journey from the publisher to a library and finally to you. Usage ... you are conducting research on machine translation, optical character recognition or other areas where access to a large amount of text is helpful, please contact us. We en...
Ngày tải lên: 30/03/2014, 01:20
... arterioles, as well as the endothelium lining the lacunar spaces of the corpus cavernsoum; and (c) the endocrine milieu that regulates the fibroelastic properties of the penis via tissue maintenance and ... 1). Adipokines are considered to facilitate mono- cyte adhesion and migration into the vascular wall and the conversion of monoctyes to macrophages. Increased...
Ngày tải lên: 18/02/2014, 06:20
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... Cys22Ala and Cys82Val was constructed by overlapping PCR using oligonucleotide primers N8517 (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and ... 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using V NAR terminal oligonucleotide primers [17] to complete the fra...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo "The role of color luminescence centers Mn, Cu, Co in the semicondutors with wide band gap ZnS, ZnO and their applications " pptx
... ions and ions of the lattice and between Cu 2+ each other make the intensity of the green band decrease. Hence, at x Cu = 5.10 -4 mol% the intensities of these two bands are equal to each other ... intensity. As concentration of Mn increases, the intensity of the blue band decreases while the intensity of the yellow-orange band increases gradually and r...
Ngày tải lên: 22/03/2014, 11:20
Budget Impasse Hinges on Confusion among Deficit Reduction, Tax Increase, and Tax Reform: An Economic Analysis of Dual Capacity and Section 199 Proposals for the U.S. Oil and Gas Industry ppt
... generally applicable tax, and in all other cases limit the creditable tax to the amount that non-Dual Capacity taxpayers would pay. The effect would levy a double- tax on U.S based oil and gas ... Louisiana, Pennsylvania, Texas, and Washington. 38 In a September 2010 report entitled The Regional and National Impact of Repealing Section 199 and Dual Capacity Tax Cr...
Ngày tải lên: 31/03/2014, 07:20
Assessment of Control Technology Options For Petroleum Refineries in the Mid-Atlantic Region Final Report potx
... implementation mechanisms, as necessary and appropriate, as part of their control strategy analysis process for attaining the 8-hour ozone and fine particulate National Ambient Air Quality Standards ... MARAMA The Mid-Atlantic Regional Air Management Association is an association of ten state and local air pollution control agencies. MARAMA's mission is to strengthen t...
Ngày tải lên: 05/03/2014, 11:20
Cisco Systems - Scaling the network with NAT and Pat pot
... the NAT Translation Table • Clears a simple dynamic translation entry containing an inside translation, or both inside and outside translation Router#clear ip nat translation inside global-ip ... local-ip [outside local-ip global-ip] • Clears all dynamic address translation entries Router#clear ip nat translation * • Clears a simple dynamic translation entry containing an outside...
Ngày tải lên: 06/03/2014, 15:20
Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx
... N-terminal primer: 5¢-AAC CAT GGC TAA AGC AGA TTG TAA TGGTGCATGT-3¢; C-terminal primer: 5¢-AAG AAT TCTTATTATCCAGTTGGATGTATGCAGAA-3¢. The amplified sequence was cloned into plasmid pET- 3 2a( +), via the NcoIandEcoRI ... peptide. The results of our analyses of the 4-kDa peptide alanine variants are shown in Table 2 and Fig. 6. Figure 6 shows the ratio of the K d value of...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot
... as templates. To generate the huTDPND39 variant by PCR mutagenesis, oligonucleotides of 5¢-GCAGCAAATGAGC CCAGGTACACCTGTTCC-3¢ and 5¢-GGAGGGCACC CACATGTTCCCATGC-3¢ were used as the forward and reverse ... primers. Similarly, oligonucleotides of 5¢-AAGTAT AACTCTCGAGCCCTCCACATCAAGG-3¢ and 5¢-GG AGGGCACCCACATGTTCCCATGC-3¢ were used as primers to generate the huTDPND174 variant. Ge...
Ngày tải lên: 31/03/2014, 21:21