Báo cáo khoa học: A new bright green-emitting fluorescent protein – engineered monomeric and dimeric forms pptx

... Press, New York. 44 Karasawa S, Araki T, Yamamoto-Hino M & Miyawaki A (2003) A green-emitting fluorescent protein from Galaxeidae coral and its monomeric version for use in fluorescent labeling. ... Properties, Applications, and Protocols (Chalfie M & Kain SR eds), pp. 3 9–6 5. John Wiley & Sons, Inc., New Jersey. 34 Nagai T, Ibata K, Park ES, Kubota M, Mi...

Ngày tải lên: 06/03/2014, 11:20

... (5¢-GAGGTGGACGAAGAAC CAGCACACG-3¢), H192AZ (5¢-TGCTGGTTCTTCGT GCACCTCTGCTGTAAC-3¢), and H192AF (5¢-GTGAG GCCCTGCTCGCTGTTACAGCAGAGGTGC-3¢). All mutant genes were cloned into a pUC18 vector and sequenced ... ARG2 proteins from V. radiata (accession no. P32292) and A. thaliana (accession no. AAC19273), and with the G3 protein from H. vulgare (accession no. CAA55482). Ó FEBS 2004 A...

Ngày tải lên: 16/03/2014, 18:20

... 1-1, Miyazaki 4-chome, Miyamae-ku, Kawasaki City, Kanagawa 213, Japan (fuku@tsl.cl.nec.co.jp, ohyama~tsl.cl.nec.co.jp, miya@tsl.cl.nec.co.jp) ABSTRACT This paper describes a new hardware algorithm ... A HARDWARE ALGORITHM FOR HIGH SPEED MORPHEME EXTRACTION AND ITS IMPLEMENTATION Toshikazu Fukushima, Yutaka Ohyama and Hitoshi Miyai C&C Systems Research Laboratories, NEC Co...

Ngày tải lên: 21/02/2014, 20:20

... that treating AA as a text classifica- tion problem is viable, but the feature types are all fairly shallow, and the approach doesn’t make effi- cient use of the training data as a separate classifier is ... 13 3–1 42. ACM. T.K. Landauer and P.W. Foltz. 1998. An introduction to latent semantic analysis. Discourse processes, pages 25 9–2 84. T.K. Landauer, D. Laham, and P.W. Foltz....

Ngày tải lên: 20/02/2014, 04:20

... Pharmacol 139, 29 5–3 01. 19 Martins RD, Alves RS, Martins AM, Barbosa PS, Evangelista JS, Evangelista JJ, Ximenes RM, Toyama MH, Toyama DO, Souza AJ et al. (2009) Purification and characterization ... constitute a new, monophyletic PLA 2 clade. Abbreviations AcPLA 2 , Adamsia carciniopados phospholipase A 2 ; AtxC, ammodytoxin C; PDB, Protein Data Bank; PLA 2 , phospholipase A 2...

Ngày tải lên: 06/03/2014, 11:20

... 110, 95 6–9 64. 10 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin ... activity TAPA CatE activity CaD activity TAPA CatE activity CaD activity A B C Fig. 5. Distribution of TAPA, CatE and CatD activity in subcellular fractions of the cell lines (A) HaCa...

Ngày tải lên: 07/03/2014, 09:20

... cyanobacteria, corals and other marine organisms are much more advanced than those of mammals because photosynthetic organisms depend on solar irradiation as their primary source of energy, and ... continuous survival under direct and UV radiation [1 1–1 3]. In addition to DNA repair mechanisms such as photoreactivation and excision repair, accumulation of carotenoids, detoxifying e...

Ngày tải lên: 07/03/2014, 15:20

... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGC TACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGAT...

Ngày tải lên: 07/03/2014, 21:20

... protein – Candida glabrata CAG60779 543 – upCangl4 unknown protein – Candida glabrata CAG61779 827 – upDanre1 unknown protein – Danio rerio AAH44421 293 – upDanre2 unknown protein – Danio rerio AAH67184 ... unknown protein – Caenorhabditis elegans AAK82903 346 – upCangl1 unknown protein – Candida glabrata CAG59109 682 – upCangl2 unknown...

Ngày tải lên: 07/03/2014, 21:20

... and summarization. In- formation Processing and Management, 33(2):19 3– 207. C. N. Satoshi, S. Satoshi, M. Murata, K. Uchimoto, M. Utiyama, and H. Isahara. 2001. Sentence ex- traction system assembling ... simplification and lexical expansion. Information processing and management, 43(6):160 6–1 618. R.S. Varga. 1962. Matrix Iterative Methods. Prentice- Hall. G. A. Vignaux and...

Ngày tải lên: 07/03/2014, 22:20