Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
... Re-engineering the discrimination between the oxidized coenzymes NAD + and NADP + in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme Marina ... kinetic analysis The coenzyme specificity of the mutant enzymes was initially assessed using the best available commercial coen...
Ngày tải lên: 06/03/2014, 00:20
... on sHsps using bovine a- crystallin to stabilize partially dena- turedproteinsduringreactivationinanATP-dependent manner [24] and indicating the involvement of ATP in substrate release [25]. In this ... alignment of recombinant MTB HSP 16.3 and recombinan t hum an aB-crystallin. Amino-acid sequence a lignment between recombinant MTB H SP 16.3 and h uman aB-crystallin was...
Ngày tải lên: 23/03/2014, 21:21
... their roles in controlling acid secretion and as growth factors in the gastrointestinal tract. Several lines of evidence, including the facts that transferrin binds gastrin, that gastrins bind ferric ... complex, EDTA was injected into the BIAcore to chelate any available iron. As soon as the EDTA was injected, the association between gastrins and ApoTf was disrupted, in...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc
... 295 1A GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC 2951B GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC 2951C AGGAAGGCCGGCAAATGGC 2951D TTCACGTGAGATAAGCTCCC 2951E ACGGTTTCGGTGAAGCCAG 2951L ACAATTAATTAACAGTATGTACGAGCGATGCG 2951M ... ACAATTAATTAACAGTATGTACGAGCGATGCG 2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTG ppsE ppsE1 GACTAGTTTAAACGGATCGACGAGTTCGACGC ppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGC ppsE3 CGTTCTGGAGCAACCTTC...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: Structural basis for the interaction between dynein light chain 1 and the glutamate channel homolog GRINL1A docx
... particularly involving the N-terminus of the peptide. These interactions may increase the stability and binding affinity and play important roles in bind- ing specificity. Similar electrostatic interactions ... atoms of H68, L429 and Y77 in strand b4, and between P431 and the aliphatic part of Q80 side chain in the loop connecting strands b4 and b5. As menti...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... blotting analysis using an antibody raised against cabbage PLDa that cross-reacted with our 90-kDa cardosin A- binding protein (Fig. 1B). After the identification of cardoon PLDa as a cardosin A- binding ... cardosin B was tested in the binding assays with PLDa (Fig. 4B), confirming the specificity of the interaction between PLDa and cardo- sin A. A characteristic fea...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: An extension to the metabolic control theory taking into account correlations between enzyme concentrations potx
... resources, the energetic cost of maintaining the cellular concentrations of enzymes [25–27], and the availability of amino ac ids or elements o f the transcription and translation machinery, which has ... analyse in detail the particular case of a linear pathway of enzymes far from saturation, considering the response of both flux and metabolite concentrations...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: Redox reaction between amino-(3,4-dihydroxyphenyl)methyl phosphonic acid and dopaquinone is responsible for the apparent inhibitory effect on tyrosinase doc
... reaction it was accompanied by a steady increase of absorbance at 320 nm, where the absorption maxima of dopachrome and 3,4- dihydroxybenzaldehyde overlap. At the same time the increase of absorbance ... dopachrome. Changes in the UV/Vis spectra of a mixture of compound 1 and Dopa oxidized by tyrosinase indicated that this was indeed the case (Fig. 3C). In t...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... much turmoil regarding the ‘life is sacred at any cost’ maxim [1]. Current technology is capable of indiscriminately maintaining some of the vital functions of the body, but the same technology ... not necessarily allow us to heal underlying disease processes [2]. An unintended side effect of modern technological advances has been the plausibility of maintaining moribund p...
Ngày tải lên: 25/10/2012, 10:45
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... 7,3. 52 Matsuda M, Shinomiya A, Kinoshita M, Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, Hamaguchi S, Sakaizumi M & Nagahama Y (2007) DMY gene induces male development in genetically female ... abundant dmrt1 expression during preparatory and prespawning and spermatogenesis periods was seen, in contrast to a gradual decrease thereafter during spawning ⁄ spermination. This...
Ngày tải lên: 14/02/2014, 19:20