Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
... Re-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme Marina ... kinetic analysis The coenzyme specificity of the mutant enzymes wasinitially assessed using the best available commercial coenzymes without further purification. Values of kcat,Km and kcat⁄ ... Km and the 0.3% NAD+contamination in 1 mm NADP+is far below Km.Nevertheless, a rate 1 ⁄ 200 of the rate in a standardNAD+reaction may be anticipated. A detailed re-analysis of the...
- 9
- 526
- 0
Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx
... onsHsps using bovine a- crystallin to stabilize partially dena-turedproteinsduringreactivationinanATP-dependentmanner [24] and indicating the involvement of ATP in substrate release [25]. In this ... alignment of recombinant MTB HSP 16.3 and recombinan t hum an aB-crystallin. Amino-acid sequence a lignment between recombinant MTB H SP 16.3 and h uman aB-crystallin wasaligned using the MULTALIN ... separatereports, ATP increased the refolding of xylose reductase bytotal a- crystallin [34], increased the binding of a- crystallin tolens membranes, and inhibited the chaperone activity of a plant sHsp...
- 8
- 310
- 0
Báo cáo khoa học: Definition of the residues required for the interaction between glycine-extended gastrin and transferrin in vitro pptx
... their roles in controllingacid secretion and as growth factors in the gastrointestinal tract. Severallines of evidence, including the facts that transferrin binds gastrin, thatgastrins bind ferric ... complex, EDTA wasinjected into the BIAcore to chelate any available iron.As soon as the EDTA was injected, the association between gastrins and ApoTf was disrupted, indicatingthat ferric ions ... [12] and Gamide [13].To characterize the involvement of the glutamates in the interaction of the peptide with ApoTf, Gglymutants in which alanine was substituted for glutamate at positions 7 and...
- 9
- 543
- 0
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc
... 295 1A GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC2951B GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC2951C AGGAAGGCCGGCAAATGGC2951D TTCACGTGAGATAAGCTCCC2951E ACGGTTTCGGTGAAGCCAG2951L ACAATTAATTAACAGTATGTACGAGCGATGCG2951M ... ACAATTAATTAACAGTATGTACGAGCGATGCG2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTGppsE ppsE1 GACTAGTTTAAACGGATCGACGAGTTCGACGCppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGCppsE3 CGTTCTGGAGCAACCTTCGppsE4 GGTCGAGGAAGTACGTGACres ... GCTCTAGAGCAACCGTCCGAAATATTATAAAres2 GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATCPhthiocerol dimycocerosates in M. tuberculosis R. Sime´one et al.1966 FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors...
- 13
- 536
- 0
Báo cáo khoa học: Structural basis for the interaction between dynein light chain 1 and the glutamate channel homolog GRINL1A docx
... particularly involving the N-terminus of the peptide. These interactions may increase the stability and binding affinity and play important roles in bind-ing specificity. Similar electrostatic interactions ... atoms of H68, L429 and Y77 in strand b4, and between P431 and the aliphatic part of Q80 side chain in the loop connectingstrands b4 and b5.As mentioned above, conserved Q234 in nNOS and other ... glutamine that is the usual hallmark of DYNLL1 binding sequences, yet binds to DYNLL1 at the same binding site and in similar fashion. A hierarchy in the binding affinity of DLC8 targetshas been...
- 11
- 474
- 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... blotting analysis using an antibody raisedagainst cabbage PLDa that cross-reacted with our90-kDa cardosin A- binding protein (Fig. 1B). After the identification of cardoon PLDa as a cardosin A- binding ... cardosin B was tested in the binding assays with PLDa (Fig. 4B), confirming the specificity of the interaction between PLDa and cardo-sin A. A characteristic feature of plant PLDa is the C2domain at ... protein after preincubation of the antibody against recombinant cardosin A with nativecardosin A (Fig. 2B).Molecular cloning of C. cardunculus L PLDa cDNA and characterization of the deduced amino-acidsequenceTo...
- 13
- 455
- 0
Báo cáo khoa học: An extension to the metabolic control theory taking into account correlations between enzyme concentrations potx
... resources, the energeticcost of maintaining the cellular concentrations of enzymes[25–27], and the availability of amino ac ids or elements o f the transcription and translation machinery, which has ... analyse in detail the particular case of a linearpathway of enzymes far from saturation, considering the response of both flux and metabolite concentrations.Linear models of redistribution of ... y,suchas the flux in the pathway or the concentration of a metabolite, toan in nitesimal change in the activity (concentration) of enzyme Ek, Kacser & Burns [1] and Heinrich & Rapoport...
- 17
- 429
- 0
Báo cáo khoa học: Redox reaction between amino-(3,4-dihydroxyphenyl)methyl phosphonic acid and dopaquinone is responsible for the apparent inhibitory effect on tyrosinase doc
... reaction it wasaccompanied by a steady increase of absorbance at 320 nm,where the absorption maxima of dopachrome and 3,4-dihydroxybenzaldehyde overlap. At the same time the increase of absorbance ... dopachrome.Changes in the UV/Vis spectra of a mixture of compound 1 and Dopa oxidized by tyrosinase indicated that this wasindeed the case (Fig. 3C). In the initial phase of the reactionFig. 3. Spectral changes ... 3-(3,4-dihydroxyphenyl)alanine (Dopa) assubstrates, respectively). Neither was the enzyme covalentlyinactivated to a significant degree. Spectroscopic and elect-rochemical analysis of the oxidation of a mixture of...
- 7
- 534
- 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... much turmoil regarding the ‘lifeis sacred at any cost’ maxim [1]. Current technology iscapable of indiscriminately maintaining some of the vitalfunctions of the body, but the same technology ... notnecessarily allow us to heal underlying disease processes [2].An unintended side effect of modern technological advanceshas been the plausibility of maintaining moribund patients in a state of ... suspended animation; they arenot alive in the sense the we enjoy life but neither are theyable to die as long as nutrition, hydration, ventilation, and perfusion are assured. In many cases reanimation...
- 2
- 463
- 0
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... 7,3.52 Matsuda M, Shinomiya A, Kinoshita M, Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, HamaguchiS, Sakaizumi M & Nagahama Y (2007) DMY geneinduces male development in genetically female ... abundant dmrt1 expression duringpreparatory and prespawning and spermatogenesisperiods was seen, in contrast to a gradual decreasethereafter during spawning ⁄ spermination. This indi-cates that ... sex-reversalmutants in the medaka, Oryzias latipes. Genetics 173,2083–2090.12 Otake H, Masuyama H, Mashima Y, Shinomiya A, Myosho T, Nagahama Y, Matsuda M, Hamaguchi S &Sakaizumi M (2009) Heritable artificial...
- 10
- 860
- 0
Từ khóa: báo cáo tóm tắt thành tích tập thểphân tích báo cáo lưu chuyển tiền tệ như thế nàomẫu báo cáo tóm tắt thành tích tập thểbáo cáo về thị trường may mặc thế giớibáo cáo về thị trường cà phê thế giớibáo cáo về thị trường lương thực thế giớichuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP