Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
... Heterologous synthesis of cytochrome c by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery Hiroki Inoue 1 , Satoshi Wakai 1 , Hirofumi Nishihara 2 and ... cytochromes c , including the latter. Heterologous synthesis of PHCP by E. coli The E. coli System I cytochrome c biogenesis machin- ery,...
Ngày tải lên: 06/03/2014, 00:20
... fluorescence response, [S] is the ligand concentra- tion and K d is the equilibrium dissociation constant defined as the ligand concentration of half maximal increase in fluorescence intensity. Temperature-induced ... noticeably upon Glc binding (Fig. 8B ,C) . The changes in the interhelical interactions point to a major contribution in the dynamic communication between the L...
Ngày tải lên: 30/03/2014, 04:20
... cultivation conditions or gene dosage, and to upscale biomass production by fermenter cultivation for S. cerevisiae. Optimization of AtSMT expression in S. cerevisiae Sequence optimization Efficient ... Ternary complex dissociation constants were determined by calculating the reciprocal intersections of the reciprocal apparent maximal catalytic activity (V maxapp )1 ) versus recipr...
Ngày tải lên: 23/03/2014, 07:20
Tài liệu Báo cáo khoa học: Evolutionary divergence of valosin-containing protein ⁄cell division cycle protein 48 binding interactions among endoplasmic reticulum-associated degradation proteins ppt
... degeneration protein (Wld S ), this time into discrete intranuclear foci [8]. Although this is not the normal distribution of VCP, these foci do provide a site for speci c colocalization studies, ... N-terminal, VBM-containing 16 amino acids of Ube4b blocks binding of the otherwise intact protein [8], this indicates similarities between the VCP-binding sites of intact ERAD...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf
... intermediate concentration (for concentration control coefficients) in response to 1% inhibition of the reaction rate of that enzyme. The elasticity coefficient is defined as the fractional change in rate ... consumption of excess fat. However, the combination of persistent ANT inhibition by LCACs with constant activation of AMPK may have some adverse effects, because stimu...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf
... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435, Sydney, July 2006. c 2006 Association for Computational Linguistics 428 0.5 1 1.5 2 ... 2 3 4 5 6 7 8 entropy offset 429 430 431 432 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0.55 0.6 0.65 0.7 0.75 0.8 0.85 0.9 0.95 1 recall precision Bincrease Bordinary Bmax 433 0 0.1 ... 1 recall prec...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf
... (F) consists of the conserved N-terminal domain that con- tains active-site residues and part of the C- terminal domain. The structure of the N-terminal domain is conserved among species (E. coli, ... which is distinct from the corresponding structures in the N, T and G forms, in which Tris is not identified. In contrast to l-glutamate, Tris binding induces a lesser...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... cells. Discussion A major problem in the clinical chemotherapeutic treatment of cancer is intrinsic or acquired resistance to current chemotherapeutic agents [11], particularly the acquisition of MDR. This ... AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109 DKK1 CACCTTGGATGG...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Dual modulation of prothrombin activation by the cyclopentapeptide plactin pptx
... Xa. This mechanism may participate in the enhancement of fibrinolytic activity in the U937 cell system, in which plactin enhances prothrombin activation and the for- mation of inactive tcu-PA ... prothrombin activa- tion (thrombin formation) was involved in the mecha- nism of plactin action and that plactin affected this reaction. Indeed, plactin D increased prothrombin activati...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx
... to achieve nuclear localization in USP7, an obser- vation which is in line with previous studies [17]. Since bioinformatics tools did not anticipate any functional nuclear localization signal ... con- formational changes triggered by the interaction with ubiquitin. A similar mechanism was described the same year for the activation of the structural homo- logue calpain by cal...
Ngày tải lên: 07/03/2014, 05:20