Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

... who are younger than older. Many aspects of well-being of older persons are influenced by their living arrangements. In the Asian context, and specifically in Cambodia, living with an adult ... reflecting the trend towards increasing access to schooling over time during the past. More than half of older Cambodians have never attended any school. In earlier year...

Ngày tải lên: 05/03/2014, 18:20

82 435 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... 239r TAATACGACTCACTATAGGGGCACGCCCAAATCTC 239 5’S2 GCCAGCCCCCTGATGGGGGCGA (–)IRES 219r AAA TAATACGACTCACTATAGGCATTGAGCGGGTTTATCC 219 5’S2 GCCAGCCCCCTGATGGGGGCGA (–)IRES 104r AAA TAATACGACTCACTATAGACACTCATACTAACGCCATG 104 ... 5’341T7 TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT (–)IRES DSLA1 GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG DSLA1 5’341T7 TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT (–...

Ngày tải lên: 20/02/2014, 01:20

15 598 0
Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

... a golfer take a giant step to avoid a line by stepping over it, rather than walk all the way around the line. That’s okay in fact, it may often be the best thing to do in order to keep play ... with a 9-iron instead of a full wedge, just to guard against it. Moral: Know your game and play safe. 9 around the hole: “piniquette” and the art of watching your st...

Ngày tải lên: 22/02/2014, 08:20

223 405 0
A Call from the Dark

A Call from the Dark

... Hanks and another with Charlize Theron, weren’t even in the cinemas in Australia as far as I knew! A list of labels with addresses lay on top of postal envelopes on the ground. Unopened plastic ... showers, washing my blonde hair slowly and rhythmically, just letting the steam clear my head and the soap wash all over me. It’s probably the most peaceful part of the...

Ngày tải lên: 06/11/2012, 16:13

11 471 0
Trade finance centralization in a vietnamese bank the case study of BIDV

Trade finance centralization in a vietnamese bank the case study of BIDV

... were a boom of activities in banking industry as well as in the capital and real estate markets, leading to the dominance of state-owned commercial banks and joint- stock commercial banks. At the ... Nevertheless, trade finance is a flat market. Despite tremendous growth in the volume of international trade, the use of trade finance tools is flat. Actually, toda...

Ngày tải lên: 27/09/2013, 21:58

96 755 1
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

... funding and time for joint working, and in the education of all healthcare professionals involved in the treatment of cancer pain. 14.1 Surveys of working with Pain Management and Palliative Care • ... Professor of Palliative Medicine Marie Fallon Professor of Palliative Medicine Paul Farqhuar-Smith Consultant in Pain Medicine, Anaesthesia and Intensive Care and membe...

Ngày tải lên: 14/02/2014, 21:20

116 548 0
Tài liệu Defending Economic and Social Rights in Cambodia A High-Risk Activity pdf

Tài liệu Defending Economic and Social Rights in Cambodia A High-Risk Activity pdf

... Human Rights in Cambodia FIDH-OMCT / PAGE 12 b) International Framework The Government of Cambodia acceded to the main international human rights treaties in 1992, including the International ... was not in a position to verify the accuracy of the claims in each case. However, the extent of the information received and the affirmation of similar incidents con...

Ngày tải lên: 20/02/2014, 19:20

32 432 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc

Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc

... instance of the point made in the last paragraph, William Chauvenet was one of the intellectual mathematical leaders of nineteenth century America. He founded the U. S. Naval Academy in Annapolis ... that the American way of doing business has played a notable role in the development of mathematics. In America, if you are a hard-working and successful mathema...

Ngày tải lên: 21/02/2014, 09:20

334 515 0
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense ... strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-...

Ngày tải lên: 22/02/2014, 04:20

9 616 0
Adolescent Sexual and Reproductive Health in Malawi: Results from the 2004 National Survey of Adolescents pdf

Adolescent Sexual and Reproductive Health in Malawi: Results from the 2004 National Survey of Adolescents pdf

... Research, Zomba, Malawi, James Kaphuka, the National Statis- tical Office, Zomba, Malawi; and Dixie Maluwa- Banda, University of Malawi, Chancellor College, Zomba, Malawi. The authors thank their ... (Uganda); Kofi Awusabo-Asare and Akwasi Kumi-Kyereme, University of Cape Coast (Ghana); Alex Ezeh, African Population and Health Research Center (Kenya); and Pav Govindasamy, Albert Themm...

Ngày tải lên: 05/03/2014, 16:20

152 658 0
w