Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx
... pepti- dylarginine deiminase) . Mouse cortical granules contain PAD To ascertain if mouse cortical granules contain PAD, anti- bodies made against mouse ePAD and human recom- binant PAD V (anti-PAD V ... Biology and Endocrinology Open Access Research Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplanta...
Ngày tải lên: 05/03/2014, 17:20
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot
... exponential amplification. Primer sequences used were as follows: cycD-F, 5¢-GGGATCCCA CATTGTATTCG-3¢; cycD-R, 5¢-ACGGAGCTTTGAAG CCAGTA-3¢; cycE-F, 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, ... develop- ment and gain insight into mechanisms of Jmj-medi- ated chromatin regulation, we have taken advantage of Drosophila melanogaster as a model organism. We show he...
Ngày tải lên: 23/03/2014, 07:20
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... siRNA: sense, 5¢-AGGACUUCUUGAAAGGCAA CAUUAAAG-3¢, antisense, 3¢-UAUCCUGAAGAACUU UCCGUUGUAAUU-5¢; scrambled HO-2 siRNA: sense, 5¢-UAUAAGAGUCAGUACACAUCAUGGAAG-3¢,anti- sense, 3¢-UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢. Another ... cDNA were: forward, 5¢- AAGCTTCATGTCAGCGGAAGTG GAAAC-3¢; reverse, 5¢-CTGCAGTCACATGTAGTACC AGGCCAA-3¢. The sequence underlined is an artificial HindIII site. A full-length H...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
... S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke, R. & Aoki, K. (1998) Purification, characterization, and gene analysis of catechol 2,3-dioxygenase from the aniline-assimilating bacterium ... AB070889. RESULTS Identification of a 4-amino-3-hydroxybenzoate-assimilating organism Strain 10d grew well in the basal medium containing 4-amino-3-hydroxybenzoic acid and yeast extract and com...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC L. ... orientation. VK1.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC VK2.link GGCGGATCAGGAGGCGGAGGTTCTG...
Ngày tải lên: 23/03/2014, 13:20
What is a Mouse-Trap Car and How does it Work? pdf
... surface friction will occur is between the axle and the chassis. The interface between the axle and the chassis is called the bearing. A plain bearing can be as simple as an axle turning in a drilled ... the cause; for example, avoid using aluminum as the axle or a bearing sleeve. A ball bearing is a set of balls in the hole which is arranged so that the axle rolls on...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"
... is worth mentioning that there are 2 main forms of esophageal cancer histologically, squamous cell car- cinoma (SCC) and adenocarcinoma, and each has dis- tinct etiologic and pathologic characteristics. ... performed stratified analysis ac- cording to ethnicity (Asian and Mixed/ Caucasian group). As shown in the Table 4, we found that the increased esophageal cancer risk associate...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... immunostaining in spi- nal cord dorsal neurons was expressed using arbitrary units. Mouse Vgf radio immuno assay (RIA) C-terminal specific Vgf antibody (ab5901) was used in RIA analysis as previously ... immunocyto- chemically revealed that Vgf immunoreactive material in spinal cord motorneurons is already decreased in ~75 day old asymptomatic SOD-1 G9 3A- SOD1 ALS mice and...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Is It the Network? Solving VoIP Problems on a Wireless LAN ppt
... Acknowledgments accompany that data. In addition, Wi-Fi networks have a random backoff sequence that allows a wireless AP and the stations that connect to it to share a wireless channel. Since a detailed discussion ... PMK caching is that the initial association to each AP on the wireless LAN still requires a full 802.1X/EAP authentication so that a PMK can be create...
Ngày tải lên: 24/01/2014, 09:20
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... is the His residue that in NirS is the proximal axial ligand to the d 1 heme. Replacement of an equivalent His, His41, in NirF by Ala abolished binding of the heme to the protein. Known distal ... bifunctional dehydrogenase-ferrochelatase from Saccharomyces cerevisiae), we found that the two proteins had 24% sequence similarity. A crystal structure of Met8P has shown that th...
Ngày tải lên: 15/02/2014, 01:20