Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

... be made available soon. Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units Israel Journal of ... develop a single denominator of obstetric anesthesia activity to offset this heterogeneity. The obstetric anesthesia activity index (OAAI) The majority of anesthesia workload in the labor ward ... graduates to the specialty and dwindling immigration) and an increase in overall workload demand (particularly in obstetric anesthesia) [1]. Obstetric anesthesia workload in Israel has increased due...

Báo cáo khoa học: Identiﬁcation of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

... forward:5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, andreverse: 5¢GGATCCCCATCATTCATATACATACTTGTGGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGATGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCATTCTTCAGGTCGATATTGTGCAAC-3¢. ... hDlg interacting partners in hVSMCs. Accordingly, we used a vector encoding the hDlg PDZ1 and PDZ2 domains as bait in a yeasttwo-hybrid screening assay of a human aorta cDNAlibrary. Interestingly, ... exhibited a diffuse staining with anoccasional patchy appearance and both types of label-ing partially colocalized in these patches, suggesting the presence of aggregates (Fig. 5A) . In addition, the localization...

Báo cáo khoa học: The interaction of the Escherichia coli protein SlyD with nickel ions illuminates the mechanism of regulation of its peptidyl-prolyl isomerase activity ppt

... PPIase active site. Comparison of PPIase domains and the FK506–rapamycin interaction The PPIase domain fold is highly conserved within the large family of FKBP and FKBP-like proteins, and ithas ... ions,enabling us to gain insights into the molecular mechanism of this regula-tion. We have revealed that the PPIase module of SlyD contains an addi-tional C-terminal a- helix packed against the catalytic ... and found anatypical PPIase domain containing an additional C-ter-minal a- helix packed against the rest of the domain.This is in full agreement with the very recentlypublished structure of...

MEASURING SAFETY CULTURE IN THE AUSTRALIAN REGIONAL AIRLINE INDUSTRY: THE DEVELOPMENT OF THE AIRLINE SAFETY CULTURE INDEX

... c a người lao động.Tuy nhiên, công tác tiền lương c a công ty hiện nay còn ch a thực sựhợp lý, th a đáng so với đóng góp c a người lao động và ch a tạo ra động lựcđể khuyến khích người lao ... lập ngày 27/4/2007 được tách ra từKhối Kinh doanh Công nghiệp c a Tập đoàn Việt Á với tên giao dịch là “Viet A Industruyal System Company”, tên viết tắt là “VA INSYS” với nhiệm vụchủ yếu là ... được tầm quan trọngc a mình trong công ty. Sau đây là kết quả điều tra về đánh giá c a người laođộng đối với quan hệ gi a người lao động với người quản lý.2. Công tác tạo động lực lao động vật...

Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

... electrophoresis. The quantity of actin in the pellet was plotted against the total quantity of actin in the sample.ResultsHeat denaturation of actinBefore starting the investigation of the HSP25–actin inter-action ... when parameter A of actin was close to2.4. Increase of the time of heating at 43 °C leading todecrease of parameter A up to 2.2–2.3 was accompanied byfurther decrease of the initial rate of polymerization. ... [22]. After staining, the gels were scannedand evaluated by the ONEDSCANprogram. The intensity of the band of unhydrolyzed actin was plotted against the time of incubation.Characterization of actin...

Tài liệu MECHANICAL PROPERTIES OF THE HEART AND ITS INTERACTION WITH THE VASCULAR SYSTEM ppt

... extreme in the cardiac cycle: end-systole. At that instant of the cardiac cycle, the muscles are in their maximally activated state and it is easy to imagine the heart as a much stiffer chamber. As ... ESPVR as an elastance. Similarly, we can refer to the slopes of the instantaneous PVRs as elastances. A rough approximation of the instantaneous elastance throughout a cardiac cycle is shown in ... provide a detailed understanding of the heart as a muscular pump and of the interaction between the heart and the vasculature. The concepts of contractility, preload and afterload are paramount...

Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx

... supplemented with 50 ng of TnrA, and the mixture was incubated at 37 °C for60 min; TnrA incubated in buffer served as a control. The fate of TnrA in the samples was then analyzed byimmunoblotting with ... binding in the mutant strains probablyprotects TnrA from proteolytic degradation.Surface plasmon resonance analysis (SPR) of the GlnK–TnrA interaction As a next step, the interaction of TnrA ... was used as an analyte in SPR analysis. ATPand 2-oxoglutarate are known to be the primary effec-tors involved in PII signaling, and they strongly affectinteractions of many GlnK proteins with...

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

... to an increase in the rate of the initial fast phase, i.e. oxidation of the a chains. The rates of oxidation are reduced in the presence of chelators of heavy metal cations in most cases. An ... studies. Mansouri and Winterhalter [5]reported that the oxidation of the a chains of Hb A 0was 10times faster than that of the beta chains and that the oxidation of the beta chains was not in uenced ... phase of oxidation was due to the a chains and the slow phase was due to the bchains. Tsuruga et al. foundthat the beta chain of the tetramer does not exhibit anyproton-catalyzed auto-oxidation...

Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowﬂy Calliphora vicina pot

... combinations:(1) ABP130: ABP130-5¢(CTCGAGGGTGTTATAATGGATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAGATTCAATTATTTAGTACAAATGGCTAAGAGGCATTT);(2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAACAACAGACGATGAGGCAACTTA);(3) ... part of t hefat body of last-instar larvae (Fig. 5B). The mRNA was alsopresent in pupae and adults (Fig. 5 A) , as well a s in haemocytes of last-instar larvae (Fig. 5B). The r esults obtained ... as recognized in the a nterior as w ell as the central, but not the posterior, part of the fat body (Fig. 4 B). A clear signalwas also detected in the haemocytes. The apparent molec-ular mass of the...

Đề tài " Ergodicity of the 2D Navier-Stokes equations with degenerate stochastic forcing " pdf

... contraction due to the spatial Laplacian.1006 MARTIN HAIRER AND JONATHAN C. MATTINGLY The usefulness of the asymptotic strong Feller property is seen in the following theorem and its accompanying ... DeﬁneCn=ρn+110ρn10,Annals of Mathematics, 164 (2006), 993–1032Ergodicity of the 2D Navier-Stokes equations with degenerate stochastic forcingBy Martin Hairer and Jonathan C. MattinglyAbstract The stochastic ... variation in the initial condition ξ,we have, via the Cameron-Martin theorem, the in nitesimal change in the Radon-Nikodym derivative of the “shifted” measure with respect to the origi-nal Wiener...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM