Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... be made available soon. Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units Israel Journal of ... develop a single denominator of obstetric anesthesia activity to offset this heterogeneity. The obstetric anesthesia activity in...
Ngày tải lên: 05/03/2014, 15:20
... forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCA TTCTTCAGGTCGATATTGTGCAAC-3¢. ... hDlg interacting partners in hVSMCs. Accordingly, we used a vector encoding the hDlg PDZ1 and PDZ2 domains as bait in a yeast two-hybrid screening assay of a human ao...
Ngày tải lên: 22/03/2014, 16:20
... PPIase active site. Comparison of PPIase domains and the FK506–rapamycin interaction The PPIase domain fold is highly conserved within the large family of FKBP and FKBP-like proteins, and it has ... ions, enabling us to gain insights into the molecular mechanism of this regula- tion. We have revealed that the PPIase module of SlyD contains an addi- tional C-terminal a- he...
Ngày tải lên: 30/03/2014, 01:20
MEASURING SAFETY CULTURE IN THE AUSTRALIAN REGIONAL AIRLINE INDUSTRY: THE DEVELOPMENT OF THE AIRLINE SAFETY CULTURE INDEX
... c a người lao động. Tuy nhiên, công tác tiền lương c a công ty hiện nay còn ch a thực sự hợp lý, th a đáng so với đóng góp c a người lao động và ch a tạo ra động lực để khuyến khích người lao ... lập ngày 27/4/2007 được tách ra từ Khối Kinh doanh Công nghiệp c a Tập đoàn Việt Á với tên giao dịch là “Viet A Industruyal System Company”, tên viết tắt là “VA INSYS” với nhiệm vụ chủ yếu l...
Ngày tải lên: 19/04/2013, 23:00
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc
... electrophoresis. The quantity of actin in the pellet was plotted against the total quantity of actin in the sample. Results Heat denaturation of actin Before starting the investigation of the HSP25–actin inter- action ... when parameter A of actin was close to 2.4. Increase of the time of heating at 43 °C leading to decrease of parameter A up to 2.2–2.3...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu MECHANICAL PROPERTIES OF THE HEART AND ITS INTERACTION WITH THE VASCULAR SYSTEM ppt
... extreme in the cardiac cycle: end-systole. At that instant of the cardiac cycle, the muscles are in their maximally activated state and it is easy to imagine the heart as a much stiffer chamber. As ... ESPVR as an elastance. Similarly, we can refer to the slopes of the instantaneous PVRs as elastances. A rough approximation of the instantaneous elastance...
Ngày tải lên: 22/02/2014, 09:20
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx
... supplemented with 50 ng of TnrA, and the mixture was incubated at 37 °C for 60 min; TnrA incubated in buffer served as a control. The fate of TnrA in the samples was then analyzed by immunoblotting with ... binding in the mutant strains probably protects TnrA from proteolytic degradation. Surface plasmon resonance analysis (SPR) of the GlnK–TnrA interaction As...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... to an increase in the rate of the initial fast phase, i.e. oxidation of the a chains. The rates of oxidation are reduced in the presence of chelators of heavy metal cations in most cases. An ... studies. Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A 0 was 10 times faster than that of the beta chains and that the...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphora vicina pot
... combinations: (1) ABP130: ABP130-5¢(CTCGAGGGTGTTATAATGG ATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAG ATTCAATTATTTAGTACAAATGGCTAAGAGG CATTT); (2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAAC AACAGACGATGAGGCAACTTA); (3) ... part of t he fat body of last-instar larvae (Fig. 5B). The mRNA was also present in pupae and adults (Fig. 5 A) , as well a s in haemocytes of last-instar larvae (Fig....
Ngày tải lên: 08/03/2014, 22:20
Đề tài " Ergodicity of the 2D Navier-Stokes equations with degenerate stochastic forcing " pdf
... contraction due to the spatial Laplacian. 1006 MARTIN HAIRER AND JONATHAN C. MATTINGLY The usefulness of the asymptotic strong Feller property is seen in the following theorem and its accompanying ... Define C n = ρ n+1 10 ρ n 10 , Annals of Mathematics, 164 (2006), 993–1032 Ergodicity of the 2D Navier-Stokes equations with degenerate stochastic forcing By Martin Hair...
Ngày tải lên: 29/03/2014, 07:20