The analysis of vitamin c

The analysis of vitamin c

The analysis of vitamin c

... large doses of vitamin C are helpful in preventing cancer. The vitamin C content of foods can easily be determined by oxidizing ascorbic acid, C 6 H 8 O 6 to dehydro-L-ascorbic acid, C 6 H 6 O 6 : ... O O +2H + +2e - O O O O OHOH C H C C H C H H OH OH OHH OHH Vitamin C Dehydro-L-ascorbic acid This reaction is very slow for ascorbic acid...
Ngày tải lên : 03/03/2014, 11:49
  • 7
  • 729
  • 0
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

... Program, Belgian Science Policy; and the Fonds de la Recherche Scientifique Me ´ dicale. CLL is a fellow of the Fonds National de la Recherche Scientifique (FNRS). References 1 Smirnoff N (2001) l-Ascorbic acid ... UDP- glucuronate influx into microsomes [11]. This involves conversion of UDP-glucuronate to UMP in the lumen of the vesicles and exchange of the latter with cytosol...
Ngày tải lên : 19/02/2014, 07:20
  • 12
  • 659
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev- Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A-3¢. The PCR product was cloned into the pDONR201 vector, and the resulting plasmid, ... either because its concentrations were below the detection limit or because of the lack of the l-gulono-1,4-lactone su...
Ngày tải lên : 07/03/2014, 12:20
  • 11
  • 571
  • 0
The analysis of theme and rheme in  little house on the prairie = sự phân tích về đề ngữ và thuyết ngữ, thông qua truyện ngôi nhà nhỏ trên thảo nguyên

The analysis of theme and rheme in little house on the prairie = sự phân tích về đề ngữ và thuyết ngữ, thông qua truyện ngôi nhà nhỏ trên thảo nguyên

... 36.5% of occurrence in those two chapters. The use of Interpersonal Themes dominates 20.4%. And the occurrence of Topical themes rates the most with 43.1%. The result of the above survey can be ... English. Theme and Rheme can be recognized in the metafunction of the clause as a message. Theme is a formal category in the analysis of sentences (or clauses in a co...
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... contents (unit: C 6 ) and calculation of the first derivative of this function. The flux rate of CO 2 into sucrose synthesis (r CO 2 !Suc ) was caclulated as the difference between the rate of net photosynthesis ... rates as a function of time of cold exposure, (b) comparison of the magnitudes of the various interconversion rates, and (c) lineup of the accessio...
Ngày tải lên : 14/02/2014, 22:20
  • 13
  • 707
  • 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

... to the double bond between C2 2 and C2 3 of these molecules. The biological significance of P450scc-catalysed metabolism of vitamin D and its precursors cannot be underestimated because P450scc-generated ... 17a,20,23-trihydroxyvitamin D3. The major products disso- ciate from the P450scc active site and accumulate at a concentration well above the P450scc concentration. Our...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 704
  • 0
Tài liệu AN INTRODUCTION TO THE ANALYSIS OF ALGORITHMS pdf

Tài liệu AN INTRODUCTION TO THE ANALYSIS OF ALGORITHMS pdf

... that now face researchers because of the emergence of computers and computational models. Chapters 6 through 9 move the fo- cus back toward computer science, as they cover properties of combinatorial structures, ... theory of algorithms often depend on solving recurrences for estimating and bounding the performance characteristics of algorithms. Specically, the “divide-and-...
Ngày tải lên : 19/02/2014, 20:20
  • 593
  • 4.2K
  • 0
The analysis of AHAs in cosmetic

The analysis of AHAs in cosmetic

... that the analysis HOCH 2 COOH Glycolic acid(pKa=3.82) Lactic acid(pKa=3.86) Citric acid(pKa=3.13) Malic acid(pKa=3.40) Maleic acid(pKa=1.83) COOH COOH CH 3 OH CCH=CHCOOH OH CH 2 COOH HOCCOOH CH 2 COOH HOCHCOOH CH 2 COOH Figure ... min glycolic acid malic acid Is (maleic acid) citric acid lactic acid a b Figure 1. HPLC Chromatograms of a cream blank extract (a) and cali- brators (b). Con...
Ngày tải lên : 03/03/2014, 11:49
  • 6
  • 618
  • 0

Xem thêm