Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx
Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx
... English and a French
versions of a software manual contain 628 and 640
paragraphs, respectively. In all, there are 30 para-
graphs embedded in them which do not have a trans-
lation (some in fact ...
algorithm that is more robust in detecting insertions
and deletions which I use for aligning paragraphs.
3.1 Aligning Paragraphs
The paragraph alignment algorithm relies...
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... protein is required for an intact binding
interface [3,4].
As a protein mutagenesis strategy, phage-display offers
a number of important advantages. The technology for
generating large libraries ... based on varying stabilities. Remarkably, we
have found that, at least in some circumstances, a quanti-
tative correlation to biophysical data can be obtained from
a statistical anal...
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... discriminant analysis (LDA).Thisstatistical
multivariate method is supervised. It searches for the
variables containing the greatest interclass variance and
the smallest intraclass variance, and constructs ... greatest
part of the original data information.
In the second part of our work, we focused on the
biochemical information available i n infrared s pectra, and
we found that infrared...
Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc
... a standard for almost all corpora,
more and more of them are nowadays annotated
with refined syntactic information. Examples
are the Penn Treebank (Marcus et al., 1993) for
American English annotated ... system
chosen.
3.1 Initialising a Treebank
The input format of treebanks
fsq
can cope with is
the NEGRA export format (Brants, 1997). This
format is designed for data exchange and...
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) for amplification of pyk. ... (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4
(5¢-CTAGTCTAGATGAGCTCCAG...
Tài liệu Báo cáo khoa học: "Event Extraction in a Plot Advice Agent" doc
... both natural language understanding and
advice generation in the domain of narrative in-
struction. The background application is a fully
automated plot analysis agent to improve the writ-
ing ... Extraction in a Plot Advice Agent
Harry Halpin
School of Informatics
University of Edinburgh
2 Buccleuch Place
Edinburgh, EH8 9LW
Scotland, UK
H.Halpin@ed.ac.uk
Johanna D. Moore
School of...
Tài liệu Báo cáo khoa học: "Automatic Construction of Polarity-tagged Corpus from HTML Documents" docx
... domain adaptation technique,
and it is one future work.
Furthermore, we examined the variance of the
accuracy between different domains. We trained
Naive Bayes on each data set and investigate ... linguistic patt ern. Be-
cause we treat Japanese, the pattern that is dis-
cussed in this paper depends on Japanese gram-
mar although we think there are similar patterns in
other languages incl...
Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx
... Events, and
Relations
An important property of a natural language system
is that it often has only partial information about the
individuals (objects, events, and relations) that are talked
about. ... binary relations, we can
generalize our representation by introducing the
predicate
ROLE
and making rolenames into individuals
in the domain.
ROLE(o, r, v)
asserts that individual...
Tài liệu Báo cáo khoa học: "Contrastive accent in a data-to-speech system" doc
...
Another advantage, pointed out in (Gardent et al.,
1996), is that a HOU algorithm can take world know-
ledge into account, which is sometimes necessary for
determining contrast. For instance, ... typed data structure containing data on a soccer
match. So-called syntactic templates (van Deemter
and Odijk, 1995) are used to express parts of this
data structure. In GoalGetter,...
Tài liệu Báo cáo khoa học: "Ambiguity resolution in a reductionistic parser" pot
...
Adverbial
Adverbial or postmodifier
@CC Coordinator
@CS Subordinator
AUX
Auxiliary
MV Main verb
MAINC
mainc
Main clause
Non-finite verbal
fragment
n-head Nominal fragment
a- head ... Helsinki, 1991.
[Tapanainen, 1992] Past Tapanainen. Jk/irellisiin
automaatteihin perustuva luonnollisen kielen
j/isennin (A finite state parser of natural lan-
guage). Licentiate (pre-doctoral)...