Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx

... TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REALTIME PARSING ABSTRACT Hiyan Alshawi, Bran Boguraev, Ted Briscoe Computer Laboratory, Cambridge University Corn Exchange Street Cambridge ... especially on grammatical theory - for example, Generalised Phrase Structure Grammar' (GPSG) (Gazdar et al., In Press), Lexical Functional Grammar (LFG) (Kaplan & Bresnan, 198...

Ngày tải lên: 22/02/2014, 09:20

... IS -A relation that holds between target and comparison set (cf. Relation 2 in Section 3). They 68 are a good initial focus for a computational ap- proach because both their target and comparison ... that their sys- tem represents a powerful way of dealing with su- perlatives computationally, a closer inspection of their approach, and in particular of the gold stan- dard data se...

Ngày tải lên: 20/02/2014, 12:20

... representation languages as FRL, KLONE and KIIL. Frames have played dual functions. They have been used as a way to organize the inferences, and also as a structural representation of what is ... ACCOUNTS. FOR EACH ACCOUNT THE BANK WANTS A LIST SHOWING THE BALANCE AT THE BEGINNING OF THE PERIOD, THE NUMBER OF DEPOSITS AND WITHDRAWALS, AND THE FINAL BALANCE. THE ACCOUNTS AND TR...

Ngày tải lên: 21/02/2014, 20:20

... here allows for a balanced extension of this very smaU core. The list//3 was chosen as the statistical core vocabulary serving as a base for applying se- mantic criteria, becat, se the overall ... claim that one can achieve a fixed point from where on no new words are added to tim set, and that at this moment one has reached a rather good approximation to a semantic core...

Ngày tải lên: 22/02/2014, 10:20

... excess of information. FAQ-pages tend to also answer questions which are not asked, and also con- tain practical examples. Human-powered answers often contain unrelated information and discourse- like ... framework provided addi- tional information for each assignment, for example the time workers spent on the task. We believe this information can be used to analyse and use our data bet...

Ngày tải lên: 20/02/2014, 09:20

... interpretation is available for each syntactic node. This is guaranteed by the seman- tic rule formalism and by the fact that every lexical item has a semantics associated with it. Table 2 contains ... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that make...

Ngày tải lên: 20/02/2014, 21:20

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (...

Ngày tải lên: 15/02/2014, 01:20

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolve...

Ngày tải lên: 16/02/2014, 09:20

... 1994 Value s in 2 min - mean (b) 0 5 10 15 20 25 30 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0 annual rate-TH1 annual rate-TH2 annual rate-TH3 Annual rate Station Annual rate= ... 20 30 40 50 60 70 A2 3 A2 4 A2 5 A3 0 A3 1 A3 2 A3 4 A3 5 A3 6 A3 7 A3 8 A3 9 A4 0 A4 1 A4 2 A4 3 A4 4 A4 5 A4 6 A4 7 Wind speed (m/s) Station C...

Ngày tải lên: 18/02/2014, 13:20

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and...

Ngày tải lên: 18/02/2014, 14:20