0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx

... TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REALTIME PARSING ABSTRACT Hiyan Alshawi, Bran Boguraev, Ted Briscoe Computer Laboratory, Cambridge University Corn Exchange Street Cambridge ... especially on grammatical theory - for example, Generalised Phrase Structure Grammar' (GPSG) (Gazdar et al., In Press), Lexical Functional Grammar (LFG) (Kaplan & Bresnan, 1982) - and ... systems for the syntactic analysis of substantial fragments of natural language. These developments also demonstrate that if natural language processing systems are to be able to handle the grammatical...
  • 8
  • 393
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx

... IS -A relation that holds between target and comparison set (cf. Relation 2 in Section 3). They 68are a good initial focus for a computational ap-proach because both their target and comparison ... that their sys-tem represents a powerful way of dealing with su-perlatives computationally, a closer inspection of their approach, and in particular of the gold stan-dard data set, reveals ... theoretical linguistics, studies of su-perlatives have mainly focused on particular se-mantic properties that may only rarely occur in natural language (Szabolcsi, 1986; Heim, 1999). My goal is a...
  • 6
  • 446
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx

... representation languages as FRL, KLONE and KIIL. Frames have played dual functions. They have been used as a way to organize the inferences, and also as a structural representation of what is ... ACCOUNTS. FOR EACH ACCOUNT THE BANK WANTS A LIST SHOWING THE BALANCE AT THE BEGINNING OF THE PERIOD, THE NUMBER OF DEPOSITS AND WITHDRAWALS, AND THE FINAL BALANCE. THE ACCOUNTS AND TRANSACTIONS ... Orsanizai::Lon • "ne parser is essentially based on semantic markers and parses a sentence in to a case frame structure. The specialists contain contextual knowledge rele- vant to each...
  • 8
  • 323
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "TOWARDS A CORE VOCABULARY FOR SYSTEM A NATURAL LANGUAGE" potx

... here allows for a balanced extension of this very smaU core. The list//3 was chosen as the statistical core vocabulary serving as a base for applying se- mantic criteria, becat, se the overall ... claim that one can achieve a fixed point from where on no new words are added to tim set, and that at this moment one has reached a rather good approximation to a semantic core vocabu- lary. ... vocabulary which is needed for handl- ing any subject domain. 'llfis assumpti(m is also shared by many researchers, and it tmdcrlies the production of basic vocabularies for language...
  • 3
  • 409
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

... excess of information. FAQ-pages tend to alsoanswer questions which are not asked, and also con-tain practical examples. Human-powered answersoften contain unrelated information and discourse-like ... framework provided addi-tional information for each assignment, for examplethe time workers spent on the task. We believe thisinformation can be used to analyse and use our databetter, and ... $0.01. Amazon.comcollects a 10% (or a minimum of $0.05) servicefee per each paid reward.• Qualifications To improve the data quality, a HIT can also be attached to certain tests,“qualifications”...
  • 9
  • 610
  • 1
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc

... interpretation is available for each syntactic node. This is guaranteed by the seman- tic rule formalism and by the fact that every lexical item has a semantics associated with it. Table 2 contains ... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... Grammatical Relations, MIT Press, Cambridge. Carbonell, J., and Hayes, P. (1983). "Recovery Strategies for Parsing Extragrammatical Lan- guage", American Journal of Computational...
  • 8
  • 376
  • 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI-1 (26 cycles). The GAPDH-specific...
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... 447–453.19 Oliveira PH, Batagov A, Ward J, Baganz F & KrabbenP (2006) Identification of erythrobactin, a hydroxamate-type siderophore produced by Saccharopolyspora eryth-raea. Lett Appl Microbiol...
  • 14
  • 614
  • 0
Tài liệu Báo cáo khoa học

Tài liệu Báo cáo khoa học " Towards Better Evaluation of Design Wind Speed of Vietnam " doc

... 1994 Values in 2 min-mean (b) 051015202530 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0annual rate-TH1 annual rate-TH2 annual rate-TH3Annual rate StationAnnual rate= ... 203040506070 A2 3 A2 4 A2 5 A3 0 A3 1 A3 2 A3 4 A3 5 A3 6 A3 7 A3 8 A3 9 A4 0 A4 1 A4 2 A4 3 A4 4 A4 5 A4 6 A4 7Wind speed (m/s)StationCOM-R100 COM-R50 COM-R10 (a) 203040506070 A2 3 A2 4 A2 5 A3 0 A3 1 A3 2 A3 4 A3 5 A3 6 A3 7 A3 8 A3 9 A4 0 A4 1 A4 2 A4 3 A4 4 A4 5 A4 6 A4 7Wind ... were taken to account. Based on individual situation of each data set, threshold was (a) 6121824 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0Minimum of annual maxima and chosen...
  • 12
  • 574
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...
  • 9
  • 457
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họctowards a dictionary support environmentbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP