Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... Biochem. 269) Ó FEBS 2002 Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon -c through the upregulation of protein kinase C in rat ... Japan The effect of a-tocopheryl hemisuccinate (TS) on lipo- polysaccharide (LPS) /interferon -c (IFN) -induced nitric oxide production...

Ngày tải lên: 22/02/2014, 04:20

... the specificity in inhibitor binding using a similar method. The purpose of this study was twofold. First, we wished to elucidate the kinetic mechanism of inhibition by which neomycin B and other ... nonlinear fit of the reaction pro- gress curves, rather than relying on routinely used lin- ear fit of an arbitrarily chosen initial portion of each kinetic trace. Applying l...

Ngày tải lên: 19/02/2014, 06:20

... sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M1 3C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢. ... preponderance of octameric rings [13]. Recent studies showed that Ca 2+ enhances the strand exchange activity of human Dmc1 protein by increas- ing the...

Ngày tải lên: 19/02/2014, 07:20

... noteworthy that the amount of cytochrome c Fig. 4. Effects of CsA and BKA on the release of cytochrome c from mitochondria induced by Ca 2+ and by valinomycin. During the meas- urement of respiration, ... CsA and BKA were ineffective in preventing accelerated respiration (Fig. 1B). In contrast, as shown in Fig. 1C, valinomycin accelerated the rate of oxy...

Ngày tải lên: 17/03/2014, 10:20

... Molecular model of the P-pyridoxyl-E. coli PEP carboxykinase adduct. N e from Lys288 of the open structure of E. coli PEP carb- oxykinase (1OEN) is covalently linked to the carbonyl carbon of the P-pyridoxyl ... a function of protein size and dynamics. Quenching experi- ments by acrylamide in the presence of several combina- tions of substrates and divalent i...

Ngày tải lên: 21/02/2014, 01:21

... d(5¢-AACAACGCAGCT GGGCTCTG GAACCAT), ECF-A141Q d(5¢-TCAACCTCTAAC CAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG C CAGCACGCTAACCAC) and ECM-Q146A d(5¢-TCT ACTGCTAAC GCGGATTCTCCGCTG) following the manufacturer’s ... the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E. coli genomic DNA as template. PCR was carried out using Amplitaq enzyme accor...

Ngày tải lên: 21/02/2014, 01:21

... stimulated the synthesis of poly(A) catalyzed by yeast poly(A) polymerase. The relative activity of diadenosine polyphosphates as effectors of the poly(A) synthesis was assayed as in Fig. 4, using 0.05 ... could open new views both on the catalytic properties of yeast poly(A) polymerase and on the intracellular role of dinucleoside polyphosphates, a family of compo...

Ngày tải lên: 21/02/2014, 01:21

... over Ni-nitrilotriacetic acid resin, according to the instructions of the manufacturer. A single protein band was detected by SDS/PAGE of purified enzymes. Enzyme activities were determined by measuring the formation ... 5¢-AT TAATGGCATGCTTTACCCGT-3¢.UsingthePCR products of agmatinase with the GfiAandCfiT substi- tutions in the coding and noncoding strands, respectively...

Ngày tải lên: 21/02/2014, 01:21

... bis-hydroxymethylated. The purity of these compounds (> 96%) was checked by 1 HNMR and HPLC. Spectrophotometric determination of laccase activity The activity of laccase was determined by following the rate of ... evidence, and in contrast with the outcome of the laccase and laccase/HPI reactions, the only product observed (by 1 H-NMR), when substrate 4 i...

Ngày tải lên: 21/02/2014, 01:21

... caused by the insertion of mistranslated proteins into the cytoplasmic membrane of Escherichia coli and subsequent caging of the antibiotic inside the cells due to degradation of these proteins. ... Poland; 3 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland The oxidation-promoting reactivity of copper(II) complex of aminogl...

Ngày tải lên: 21/02/2014, 01:21