Tài liệu Báo cáo khoa học: "Negative Polarity Licensing at the Syntax-Semantics Interface" doc

... the Uterals The final step in assembling the proof net is to con- nect together the literal nodes at the top of the graph. It is at this stage that unification is applied to the variables ... survive the hypothetical and so cannot affect the meaning of the licenser in some other way. That is, the licensing constructor (£ o (A ® l)) o B can derive all of the same meanings as the nonlicensing ... introduce 'hypothetical' material. All of the NPI licensing occurs within the hypothetical (left) side of the outermost implication. Since the l resource is made available to the NPI only...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE65a-His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. ... retinol(atROL) as the substrate for the conversion of11cROL [24–27]; the substrate of RPE65 in the RPE isatRE [12]. To verify the substrate speciﬁcity of zebra-ﬁsh RPE65c, total cell lysates ... thetase to esterify the 13cROL generated in the reac-tion. Therefore, 13cROL is accumulated in the absenceof LRAT in the reaction (Fig. S3B).Under the in vitro assay conditions of the...

Tài liệu Báo cáo khoa học: Transient RNA–protein interactions in RNA folding docx

... represent the ﬂexibleresidues within the protein domain. NMR dataprovide evidence that the interaction site on the RNAis the phosphate backbone. This is also in accordancewith the demonstrated ... assay, even at very low saltconcentrations. As the latter assay would require the formation of a stable complex, the formation of onlytransiently populated RNAÆ protein complex states canbe ... annealing of the new duplex ﬁnally results in either the replacement of the original strand or the expulsion of the invadingstrand, according to the kinetics and thermodynamicsituation. If the RNA...

Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc

... MAPK-mediated phosphor-ylation of Bax at Thr167, leading to its activation inHepG2 cells [122]. On the other hand, treatment withOA increases Akt-mediated phosphorylation of Bax at Ser184, ... intri-cately interrelated; it was previously shown that either induction or inhibi-tion of phosphorylation causes cell death. Determination of the relationship between protein and phosphorylation ... located in the mitochondrial intermembrane spacedue to the presence of mitochondrial localizationsignals at their N-termini [30]. They are probablybound by their N-termini to the surface of the...

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

... hypothesize that the proton-ated state of the chaperone initiates this cycle, whereas the deprotonated state occurs upon completion of the maturation process of the partner. The nature of the signal ... from the heat of the reaction toobtain the effective heat of binding [27].DSCHeat denaturation measurements were carried out on aMicroCal VP-DSC instrument (Microcal LLC) at a heatingrate ... KÆmin)1. The denaturation temperature was deter-mined as previously described [28]. Because of the irrevers-ibility of the denaturation process, the excess molar heatcapacity of the protein...

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... within the GBD part of the protein. Another possible explanation for the observedautoinhibitory activity is that the Hth domain mediatessome intramolecular interaction, or affects the confor-mation ... indicates the base that correlates with alternative or constitutive splicing. (B) The presence of alternative splicingaround the 5¢-end of exon 6 of Meis2 and Meis3 was tested by RT-PCR. The ... that the protein encoded by the Meis2e splice variant has alimited ability to act as an effective dominant negative. The Hth domain inhibits the activity of a linkedADTo further delineate the...

Tài liệu Báo cáo khoa học: Steﬁn A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... that the cathepsin B mutations do not affect the geometry ofbinding of chagasin). The wild-type sequences havealso been preserved in the related structural studies ofprocathepsin B [22].These ... [19]. The mini loop in carboxypeptidasecathepsin X blocks the primed side of the active site,restricting access to only one residue [20].Although the structures of the mature native formof cathepsin ... tocathepsin H. To illustrate this, we calculated the aver-age distances between CA atoms of the active site cys-teine and histidine residues in cathepsins B and H and the center of CA atoms...

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... modeldipalmitoylphosphatidylcholine bilayer in the presence of the 40-residue Abpeptide (Ab40). The simulated systems examine the effects of the insertiondepth of the peptide, temperature, the protonation state ... salt concentration. Simulation set Bexamined the effects of both the protonation state of the peptide and temperature on the behavior of the system. Finally, the systems in simulation set C alsoexamined ... ofwater to one side of the bilayer to approximate the increased water-to-lipid solvation ratio and the systemsize present in the peptide–bilayer systems. Similar to the OS simulation set, these...

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... investigated the effects of the mutation on the enzymatic maturation of FVIIa and on the response of FVIIa to TF.Our measurements, in both the presence and absenceof TF, revealed that the amidolytic ... effects of the G372(223)A mutation is slightlysubstrate-dependent. The fact that the relative reduc-tion in activity was not greater in the presence ofcofactor strongly suggests that the allosteric ... subsites located in the vicinity of the active site and sensed by the peptidyl substrate areinﬂuenced, in contrast to the remote exosites, e.g. in the vicinity of the activation pocket, that affect...

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... that they comple-ment each other.Other classiﬁcation techniquesOther classiﬁcation techniques were investigated toevaluate whether they could add improvements to the new method. To further ... that look only at stability changes of the mutationcompared with the wild-type protein [22,31].Matthews’ correlation coefﬁcientMatthews’ correlation coefﬁcient (MCC) [37] was used toestimate ... mutation that has nothing to do with the cause oftheir cancer. Alternatively, the effect of the mutationalone is not sufﬁcient to cause cancer without additionalhelp from other factors. These...

Xem thêm