Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc
... the EACL 2009 Demonstrations Session, pages 61–64, Athens, Greece, 3 April 2009. c 2009 Association for Computational Linguistics Three BioNLP Tools Powered by a Biological Lexicon Abstract ... automatically extracted verb subcategorization frames Yutaka Sasaki 1 Paul Thompson 1 John McNaught 1, 2 Sophia Ananiadou 1, 2 1 School of Computer Science, Universit...
Ngày tải lên: 22/02/2014, 02:20
... Tracking Semantic Change by Visual Analytics Christian Rohrdantz 1 Annette Hautli 2 Thomas Mayer 2 Miriam Butt 2 Daniel A. Keim 1 Frans Plank 2 Department of Computer Science 1 Department of Linguistics 2 University ... stud- ies have shown that computational models are capable of clustering and disambiguat- ing senses, a more recent trend investigates whether changes in word meaning can...
Ngày tải lên: 20/02/2014, 05:20
... Finland. E-mail: Nina.Hakulinen@joensuu.fi Abbreviations:AKX,Aspergillus kawachii xylanase; ANX, Aspergillus niger xylanase; BAX, Bacillus agaradhaerens xylanase; BCX, Bacillus circulans xylanase; ... enzyme materials. We thank Reetta Kallio-Ratilainen and Johanna Aura for their technical assistance and Dr Xiaoyan Wu for assistance in protein purification. The Academy of Finland and the Nationa...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx
... MFA MATLAB NG Single time point of metabolites measured by HPLC and enzyme assays; RNA measured by assay; lipids measured by assay; biomass measured by weighting Giuseppin ML & van Riel NA ... acetate assimilation are needed as a result of a coupling between the TCA cycle and acetate activation to acetyl-CoA by acetyl-CoA transferase Stoich FBA, opt, MOMA, FVA, SNA NG NG Tim...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... expression was induced by addition of IPTG (1 mm) and Ca 2+ (1 mm) for 20 h at 20 °C. Culture supernatants and cell pellets were assayed for phytase activity and separated by SDS ⁄ PAGE. P...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... the medaka, Oryzias latipes. Proc Natl Acad Sci USA 99, 11778–11783. 9 Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N et al. (2002) ... 7,3. 52 Matsuda M, Shinomiya A, Kinoshita M, Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, Hamaguchi S, Sakaizumi M & Nagahama Y (2007) DMY gene induces male development in genetically...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc
... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronal death is accompanied by the appearance of Lewy bodies (LB), intracytoplasmic inclusions immunoreac- tive ... Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1 1 Department of Structural and Functional Biology, and...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in ADP-bound and nucleotide-free forms. ... Bando R, Hieda N & Toraya T (2004) Identification of a reactivating factor for adenosylcobalamin-dependent ethanolamine ammonia lyase. J Bacteriol 186, 6845–6854. 27 Baker JJ &...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Reductive nitrosylation of ferric human serum heme-albumin docx
... serum heme-albumin Paolo Ascenzi 1,2, *, Yu Cao 1,3, *, Alessandra di Masi 1 , Francesca Gullotta 1 , Giampiero De Sanctis 4 , Gabriella Fanali 5 , Mauro Fasano 5 and Massimo Coletta 3,6 1 Department ... Crystal structure analysis of warfarin binding to human serum albumin: anatomy of drug site I. J Biol Chem, 276, 22804–22809. 19 Petitpas I, Petersen CE, Ha CE, Bhattacharya AA, Zunszain PA,...
Ngày tải lên: 16/02/2014, 14:20