Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

... the EACL 2009 Demonstrations Session, pages 61–64, Athens, Greece, 3 April 2009. c 2009 Association for Computational Linguistics Three BioNLP Tools Powered by a Biological Lexicon Abstract ... automatically extracted verb subcategorization frames Yutaka Sasaki 1 Paul Thompson 1 John McNaught 1, 2 Sophia Ananiadou 1, 2 1 School of Computer Science, Universit...

Ngày tải lên: 22/02/2014, 02:20

... Tracking Semantic Change by Visual Analytics Christian Rohrdantz 1 Annette Hautli 2 Thomas Mayer 2 Miriam Butt 2 Daniel A. Keim 1 Frans Plank 2 Department of Computer Science 1 Department of Linguistics 2 University ... stud- ies have shown that computational models are capable of clustering and disambiguat- ing senses, a more recent trend investigates whether changes in word meaning can...

Ngày tải lên: 20/02/2014, 05:20

... Finland. E-mail: Nina.Hakulinen@joensuu.fi Abbreviations:AKX,Aspergillus kawachii xylanase; ANX, Aspergillus niger xylanase; BAX, Bacillus agaradhaerens xylanase; BCX, Bacillus circulans xylanase; ... enzyme materials. We thank Reetta Kallio-Ratilainen and Johanna Aura for their technical assistance and Dr Xiaoyan Wu for assistance in protein purification. The Academy of Finland and the Nationa...

Ngày tải lên: 20/02/2014, 23:20

... MFA MATLAB NG Single time point of metabolites measured by HPLC and enzyme assays; RNA measured by assay; lipids measured by assay; biomass measured by weighting Giuseppin ML & van Riel NA ... acetate assimilation are needed as a result of a coupling between the TCA cycle and acetate activation to acetyl-CoA by acetyl-CoA transferase Stoich FBA, opt, MOMA, FVA, SNA NG NG Tim...

Ngày tải lên: 14/02/2014, 14:20

... the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... expression was induced by addition of IPTG (1 mm) and Ca 2+ (1 mm) for 20 h at 20 °C. Culture supernatants and cell pellets were assayed for phytase activity and separated by SDS ⁄ PAGE. P...

Ngày tải lên: 14/02/2014, 15:20

... the medaka, Oryzias latipes. Proc Natl Acad Sci USA 99, 11778–11783. 9 Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N et al. (2002) ... 7,3. 52 Matsuda M, Shinomiya A, Kinoshita M, Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, Hamaguchi S, Sakaizumi M & Nagahama Y (2007) DMY gene induces male development in genetically...

Ngày tải lên: 14/02/2014, 19:20

... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...

Ngày tải lên: 15/02/2014, 01:20

... substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronal death is accompanied by the appearance of Lewy bodies (LB), intracytoplasmic inclusions immunoreac- tive ... Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1 1 Department of Structural and Functional Biology, and...

Ngày tải lên: 15/02/2014, 01:20

... K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in ADP-bound and nucleotide-free forms. ... Bando R, Hieda N & Toraya T (2004) Identification of a reactivating factor for adenosylcobalamin-dependent ethanolamine ammonia lyase. J Bacteriol 186, 6845–6854. 27 Baker JJ &...

Ngày tải lên: 15/02/2014, 01:20

... serum heme-albumin Paolo Ascenzi 1,2, *, Yu Cao 1,3, *, Alessandra di Masi 1 , Francesca Gullotta 1 , Giampiero De Sanctis 4 , Gabriella Fanali 5 , Mauro Fasano 5 and Massimo Coletta 3,6 1 Department ... Crystal structure analysis of warfarin binding to human serum albumin: anatomy of drug site I. J Biol Chem, 276, 22804–22809. 19 Petitpas I, Petersen CE, Ha CE, Bhattacharya AA, Zunszain PA,...

Ngày tải lên: 16/02/2014, 14:20