Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

... data(Utiyama and Isahara, 2003) as a gold standard. We segmented all the Japanese data with the automatic segmenter Juman (Kurohashi and Nagao, 1994). There is a caveat to this evaluation, though. ... second alignment model has already received some attention, notably by (Yamada and Knight, 2001) and (Gildea, 2003) . 2 Factor Graphs and Belief Propagation In this paper, we...

Ngày tải lên: 22/02/2014, 02:20

9 456 0
Tài liệu Báo cáo khoa học: "Learning Word Senses With Feature Selection and Order Identification Capabilities" pdf

Tài liệu Báo cáo khoa học: "Learning Word Senses With Feature Selection and Order Identification Capabilities" pdf

... have been presented, which can be cate- gorized as feature filter (Dash et al., 2002; Talav- era, 1999) and feature wrapper (Dy and Brodley, 2000; Law et al., 2002; Mitra et al., 2002; Modha and ... feature space should be stable and robust against random sampling. After deter- mination of important contextual words, we use a Gaussian mixture model (GMM) based clustering algorithm...

Ngày tải lên: 20/02/2014, 16:20

8 463 0
Tài liệu Báo cáo khoa học: "An Unsupervised Model for Joint Phrase Alignment and Extraction" ppt

Tài liệu Báo cáo khoa học: "An Unsupervised Model for Joint Phrase Alignment and Extraction" ppt

... Och, and Daniel Marcu. 2003. Statistical phrase-based translation. In Proceedings of the Human Language Technology Conference (HLT- NAACL), pages 48–54. Philipp Koehn, Amittai Axelrod, Alexandra ... Computational Linguis- tics Annual Meeting (HLT-NAACL), pages 104–111. Daniel Marcu and William Wong. 2002. A phrase-based, joint probability model for statistical machine transla- tion. pag...

Ngày tải lên: 20/02/2014, 04:20

10 641 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy Mogridge Department of Laboratory ... inducing vascular leakage that leads to shock and multiorgan failure [3–6]. The role of LeTx in anthrax pathogenesis is complex, however, and probably involves the impairment of the innate and...

Ngày tải lên: 16/02/2014, 09:20

9 579 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... isolated and purified using an Absolutely RNA kit (Agilent, Santa Clara, CA, USA). For quantitative RT-PCR, cDNA was generated using Superscript III (Invitrogen), and analyzed by PCR using a DNA engine ... intramolecular interactions, allowing access to the AD. As the autoinhibition affected an unrelated AD when this was put in place of the native Meis2d AD, it appears that any int...

Ngày tải lên: 16/02/2014, 15:20

14 753 0
Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

... DNA sequences (PL DNAzyme, 5¢-GAATTCTAATAC GACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢; 8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCG GGCCTC-3¢; DRc DNAzyme, 5¢-GAATTCTAATACTCC GAGCCGGTCGGGCCTCTTTTTAAGAAC-3¢) ... 7.0) at 23 °C. The self-cleavage of DRc DNAzyme was A BC FED Fig. 3. Characterization of the DNA-cleaving and RNA-cleaving reactions catalyzed by DRc DNAzyme. (A C) Analyses of DNA cleav...

Ngày tải lên: 16/02/2014, 15:20

7 602 0
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... growth factor-like peptide regulates adult development of the silkmoth Bombyx mori Naoki Okamoto 1 , Naoki Yamanaka 2, *, Honoo Satake 3 , Hironao Saegusa 1, , Hiroshi Kataoka 2 and Akira Mizoguchi 1 1 ... consisting of an A- chain and a B-chain, whereas IGFs are single- chain peptides with domains B, C, A and D, and the major function of insulin is to control carbohydrate metab...

Ngày tải lên: 18/02/2014, 13:20

12 707 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... 1-palmitoyl-2-oleyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids Inc., Alabaster, AL, USA) at lipid-to- protein ratios of 0.5, 1.0 and 1.5 w ⁄ w. The mixture was dialyzed in 50 lL buttons (Hampton Research, Aliso Viejo, CA, USA) against ... concentrate the c rings and to remove excess salt, the sample was loaded onto an Amicon Ultra-4 tube (30 000 Da molecular mass cut-off; Amicon, Ha...

Ngày tải lên: 18/02/2014, 17:20

9 773 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthy tissue counterparts ... of the mRNAs encompassing full-length DAPK-1 and s-DAPK-1 in colorectal carci- nomas ( 1a) and their normal tissue counterpart ( 4a) using real-time PCR. As indicated, DAPK-1 and s-DA...

Ngày tải lên: 18/02/2014, 17:20

11 659 0
w