Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

... almost all corpora, more and more of them are nowadays annotated with refined syntactic information. Examples are the Penn Treebank (Marcus et al., 1993) for American English annotated at the ... therefore needs to opt for a general data structure. And the one data structure that fits 180 most easily with all treebank formats is that of a finite first-order structure. One big...
Ngày tải lên : 22/02/2014, 02:20
  • 8
  • 375
  • 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations ... Another major focus has been to obtain quanti- tative data on b-sheet stability determinants. We have suc- cessfully adapted a phage-display method for quantitating a nities of prote...
Ngày tải lên : 19/02/2014, 12:20
  • 7
  • 502
  • 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells Anthoula Gaigneaux, Jean-Marie Ruysschaert and Erik Goormaghtigh Laboratory of Structure and ... 1 cm )1 . Data analysis All spectra were treated with i n-house s oftware w orking in a MATLAB environment ( MATLAB 6, Mathworks Inc., Natick, USA). Spectra were separated in a training s...
Ngày tải lên : 21/02/2014, 03:20
  • 6
  • 555
  • 0
Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

... Introduction Making use of previously translated texts is a very appealing idea that can be of considerable prac- tical and economical benefit as a translation aid. There are different ways to exploit ... Nationalization Situations where a document needs re-translation are usually associated with commercial products that undergo modifications and revisions and require ac- compan...
Ngày tải lên : 22/02/2014, 10:20
  • 5
  • 456
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... Molecular Graphics System. DeLano Scienti- fic, San Carlos, CA, USA]. Acknowledgements We thank Andrea Schmidt for assistance during data collection at DESY beamline BW 7A and Achim Dick- manns for ... Leiros I, Moe E, Lanes O, Smalas AO & Willassen NP (2003) The structure of uracil–DNA glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features. Acta Crystallogr S...
Ngày tải lên : 19/02/2014, 16:20
  • 14
  • 597
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTC...
Ngày tải lên : 19/02/2014, 17:20
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: "Demonstration of the UAM CorpusTool for text and image annotation" docx

Tài liệu Báo cáo khoa học: "Demonstration of the UAM CorpusTool for text and image annotation" docx

... features='participant;human' state='active'/> <segment id='2' start='207' end='214' features='participant;organisation;company' ... file for annotation at a specific layer (each file has a button for each layer). 3 Tag Hierarchy Editing Most of the current text annotation tools lack built- in facilities for cre...
Ngày tải lên : 20/02/2014, 09:20
  • 4
  • 498
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... MaL, Melanocarpus albomyces laccase; PDB, Protein Data Bank; RlL, Rigidoporus lignosus laccase; rMaL, recombinant Melanocarpus albomyces laccase; TaLcc1, Thielavia arenaria laccase; ThL, Trametes ... asco-laccases at high protein concentrations. Database Structural data are available in the Protein Data Bank database under the accession numbers 3PPS and 2VDZ Structured digital abstract l lacc...
Ngày tải lên : 14/02/2014, 18:20
  • 13
  • 888
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data are available in ... (excluding water molecules and peptide atoms) and r j is the standard deviation of B factors. The normalized B factors have a zero mean and unit variance. All atoms that satisfy B z ‡ 4 are tre...
Ngày tải lên : 14/02/2014, 19:20
  • 14
  • 741
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

... to structure and catalysis. Biochemistry 48, 3417–3424. 31 Nakamura T, Matsumura H, Inoue T, Kai Y, Uegaki K, Hagihara Y, Ataka M & Ishikawa K (2005) Crystallization and preliminary X-ray ... National Synchrotron Radiation Research Center (Taiwan, ROC). We thank Ms M.Sakai (Osaka University) for performing ultracentrifugation analysis and Mr K. Mieda and M. Sakata (Tottori University)...
Ngày tải lên : 14/02/2014, 22:20
  • 12
  • 762
  • 0

Xem thêm