Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different lan- guages, and ... is length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which w...
Ngày tải lên: 22/02/2014, 02:20
... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different lan- guages, and ... is length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which w...
Ngày tải lên: 08/03/2014, 21:20
... corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker Vera Sheinman The Japan Institute for Educational Measurement Inc. 3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004; Nagata et al., 2005; Nagata et al., 2006; Tetreault et al., 2010b). This is one of the most active research areas in natural language processin...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... markers, we do not regard this distinction as particularly helpful, though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic ... that the proper place for describing discourse markers is a dedicated lexicon that provides a classification of their syntactic, semantic and pragmatic features and characterizes the...
Ngày tải lên: 20/02/2014, 18:20
Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx
... perfor- mance of WSD algorithms for languages such as English for which hand-crafted sense-annotated corpora have been available (Agirre et al., 2007; Erk and Strapparava, 2012; Mihalcea et al., ... the amount of data that can reasonably be annotated by hand. Leacock et al. (1998), Agirre and Lopez de La- calle (2004), and Mihalcea and Moldovan (1999) propose a set of methods for automatic...
Ngày tải lên: 22/02/2014, 03:20
Tài liệu Báo cáo khoa học: Leptin protects H9c2 rat cardiomyocytes from H2O2-induced apoptosis docx
... medium, and ana- lyzed by confocal microscopy. Caspase-3 activity assay Caspase-3 activity was measured using an Apo-ONE homo- geneous caspase-3 assay kit (Promega, Madison, WI, USA) according ... blotting was conducted using nih image software (National Institutes of Health, Bethesda, MD, USA). Statistical analysis All data presented are expressed as means ± SEM. Sta- tistical analysis was u...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: "AUTOMATIC ACQUISITION OF SUBCATEGORIZATION FRAMES FROM UNTAGGED TEXT" doc
... sufficiently large corpora and sufficiently cheap computation have become available. Three recent papers in this area are Church and Hanks (1990), Hindle (1990), and Smadja and McKeown (1990). The latter ... paper describes an implemented program that takes a raw, untagged text corpus as its only input (no open-class dictionary) and gener- ates a partial list of verbs occurrin...
Ngày tải lên: 20/02/2014, 21:20
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (TT...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... view from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dis...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mi...
Ngày tải lên: 18/02/2014, 14:20