Tài liệu Báo cáo khoa học: "HOW TO MISREAD A DICTIONARY" pot
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... genome
databanks. Interestingly, this domain was found in
some closely related bacterial species, but mainly in
nonvertebrate animals, and invariably connected via a
linker to an animal-type a- amylase ... the
noticeable exception of the a- amylase from the bacte-
rium Pseudoalteromonas haloplanktis, which displays
an additional small (21 kDa) C-terminal domain hav-
ing the size of a...
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... an N-terminal
hexahistidine tag was obtained by PCR using the
pET2 1a ⁄ PNT-
H6
plasmid [30] as the template. The forward
primer (5¢-TACCGTTAACATCGATATGCATCATCATC
ATCATCATGC-3¢) was designed to ... to
thank Antonino Natalello and Silvia Maria Doglia for
their assistance with the fluorescence spectroscopy, as
well as for critically reading the manuscript. We are
indebted to Maria Samalik...
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... administration
increased Q279E a- galactosidase A residual activity in
patient derived cells; thus, galactose was demonstrated
to be first active-site-directed pharmacologic chaperone
for a lysosomal storage disease. ... mechanisms.
Proc Natl Acad Sci USA 103, 13813–13818.
29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain
P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de-
oxynoj...
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... the top-down
approach deserve consideration for important pro-
teomics research.
Acknowledgements
We thank Barbara Baird, Ian Jardine, Neil Kelleher,
Harold Scheraga and Klaas van Wyck for valuable
discussions, ... these fragment mass values originate
from the same molecular ions, so they must all be
characteristic of that protein’s sequence and molecular
mass value. Thus, top-down data can g...
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx
... Kanto T, Hayashi N, Takehara T, Hagiwara H, Mita
E, Naito M, Kasahara A, Fusamoto H & Kamada T
(1994) Buoyant density of hepatitis C virus recovered
from infected hosts: two different features ... protease
and its cofactor NS 4A. In addition to the N-terminal
protease domain, the carboxy-terminal domain of NS3
consists of an RNA helicase and NTPase activity.
NS 4A serves as a cofact...
Tài liệu Báo cáo khoa học: Strategies to cover microbial proteomes ppt
... Poincare
´
Nancy 1,
Nancy, France. E-mail: gerard.siest@pharma.uhp-nancy.fr
We have recently proposed a five-step pharmacogenomic
approach for a new cardiovascular drug. After making a sum-
mary ... leads to modulation of leucocyte activa-
tion and may play an important role in preventing inappropriate
tissue damage during immune and inflammatory responses.
S4.5-3
Oligosaccharide microa...
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... Sequence
Forward ompA* 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG
Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG
Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC
Forward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG
Reverse ... 5¢-GCTTCAGTACTTAGAGAC
Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC
Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG
Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG
Forward rpsO...
Từ khóa: