Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx

... TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS Fernando Gomez Department of Computer Science University of Central Florida Orlando, Florida 32816 ABSTRACT An outline of a theory ... representation languages as FRL, KLONE and KIIL. Frames have played dual functions. They have been used as a way to organize the inferences, and also as a structural representation of what is re- ... theoretical ideas compared to those proposed for the understanding of human actions, although~ naturally there are aspects that are common. An important characteristic of these contexts is...

Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx

... that their sys-tem represents a powerful way of dealing with su-perlatives computationally, a closer inspection of their approach, and in particular of the gold stan-dard data set, reveals ... Elements of a Computational Treat-ment of Superlatives For an interpretation of comparisons, two things are generally of interest: What is being compared, and with respect to what this comparison ... IS -A relation that holds between target and comparison set (cf. Relation 2 in Section 3). They 68are a good initial focus for a computational ap-proach because both their target and comparison...

Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx

... syntactic analysis of substantial fragments of natural language. These developments also demonstrate that if natural language processing systems are to be able to handle the grammatical and ... linguistics, and especially on grammatical theory - for example, Generalised Phrase Structure Grammar' (GPSG) (Gazdar et al., In Press), Lexical Functional Grammar (LFG) (Kaplan & Bresnan, ... the informational structure of the dictionary. Similarly, choice of font can be varied for reasons of appearance and occasionally information normally associated with one field of an entry...

Tài liệu Báo cáo khoa học: "TOWARDS A CORE VOCABULARY FOR SYSTEM A NATURAL LANGUAGE" potx

... seen as a long-range research prt~gram rather than as a short-term goal. Motiva!ion Rcasearch on natural language processing sys- tems today strives for the construction of robust and portable ... (;ci'many lhnaih !,1'~!! at I)! ll)iBM I.BITNI'71' ABSTRACT The desire to construct robust and portable na- tural language systems has led to research on how a core vocabulary ... relate to semantic criteria? 3. What semantic criteria can be found to de- fine a core vocabulary? Definitions of a core vocabulary "l:here are several ways to define core vocab,lary,...

Tài liệu Báo cáo khoa học: "Towards Tracking Semantic Change by Visual Analyti cs" docx

... approach of Sagi et al. (2009) and analyze se-mantic change in more detail. Ideally, a startingpoint of change is found and the development overtime can be tracked, paired with a quantitative ... LinguisticsTowards Tracking Semantic Change by Visual AnalyticsChristian Rohrdantz1Annette Hautli2Thomas Mayer2Miriam Butt2Daniel A. Keim1Frans Plank2Department of Computer Science1Department ... corpus-based method of detecting meaning change is theavailability of suitable corpora. First, computing se-mantic information on the basis of contexts requires a large amount of data in order...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... Takeda N, Miyata S, Uchinok-ura S, Fukushima T, Uchiyama S, Tanaka H, NagaikeK, Shimomura T et al. (2004) Regeneration of injuredintestinal mucosa is impaired in hepatocyte growthfactor activator-deﬁcient...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... nonribosomal peptide synthetases: theemerging view from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) ... Marburg, GermanyIntroductionBacterial growth is strongly inﬂuenced by the availabil-ity of iron as an essential trace element employed as a cofactor [1]. The fact that the bioavailability of ... Fragmentation pattern of C-terminal fragment.Fig. S11. LC-MS analysis of erythrochelin hydrolysate.Fig. S12. LC-MS trace of FDAA-derivatized standards.Fig. S13. LC-MS trace of FDAA-derivatized...

Tài liệu Báo cáo khoa học " Towards Better Evaluation of Design Wind Speed of Vietnam " doc

... 1994 Values in 2 min-mean (b) 051015202530 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0annual rate-TH1 annual rate-TH2 annual rate-TH3Annual rate StationAnnual rate= ... 102030405060 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0Wind speed (m/s)StationR5-1994 R50-1994 (d) 203040506070 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0Wind ... 203040506070 A2 3 A2 4 A2 5 A3 0 A3 1 A3 2 A3 4 A3 5 A3 6 A3 7 A3 8 A3 9 A4 0 A4 1 A4 2 A4 3 A4 4 A4 5 A4 6 A4 7Wind speed (m/s)StationCOM-R100 COM-R50 COM-R10 (a) 203040506070 A2 3 A2 4 A2 5 A3 0 A3 1 A3 2 A3 4 A3 5 A3 6 A3 7 A3 8 A3 9 A4 0 A4 1 A4 2 A4 3 A4 4 A4 5 A4 6 A4 7Wind...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... speciﬁcally measures HSF1DNA-binding activity.Analytical range and precisionThe analytical range of the assay was evaluated usingknown concentrations of recombinant human HSF1instead of cell ... hD1 hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic...

Tài liệu Báo cáo khoa học: Identiﬁcation, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723RpCAbrR3 ... 706–723RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483Probe ampliﬁcation for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C ... sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas,D. melanogaster-2 and D. melanogaster-3 sequences(data not shown). By contrast, R. pachyptila aminoacid sequences do not have any...

Xem thêm