Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx

... TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS Fernando Gomez Department of Computer Science University of Central Florida Orlando, Florida 32816 ABSTRACT An outline of a theory ... representation languages as FRL, KLONE and KIIL. Frames have played dual functions. They have been used as a way to organize the inferences, and also as a structura...

Ngày tải lên: 21/02/2014, 20:20

... that their sys- tem represents a powerful way of dealing with su- perlatives computationally, a closer inspection of their approach, and in particular of the gold stan- dard data set, reveals ... Elements of a Computational Treat- ment of Superlatives For an interpretation of comparisons, two things are generally of interest: What is being compared, and with respect to...

Ngày tải lên: 20/02/2014, 12:20

... syntactic analysis of substantial fragments of natural language. These developments also demonstrate that if natural language processing systems are to be able to handle the grammatical and ... linguistics, and especially on grammatical theory - for example, Generalised Phrase Structure Grammar' (GPSG) (Gazdar et al., In Press), Lexical Functional Grammar (LFG) (Kaplan &...

Ngày tải lên: 22/02/2014, 09:20

... seen as a long-range research prt~gram rather than as a short-term goal. Motiva!ion Rcasearch on natural language processing sys- tems today strives for the construction of robust and portable ... (;ci'many lhnaih !,1'~!! at I)! ll)iBM I.BITNI'71' ABSTRACT The desire to construct robust and portable na- tural language systems has led to research on how a...

Ngày tải lên: 22/02/2014, 10:20

... approach of Sagi et al. (2009) and analyze se- mantic change in more detail. Ideally, a starting point of change is found and the development over time can be tracked, paired with a quantitative ... Linguistics Towards Tracking Semantic Change by Visual Analytics Christian Rohrdantz 1 Annette Hautli 2 Thomas Mayer 2 Miriam Butt 2 Daniel A. Keim 1 Frans Plank 2 Department of Compute...

Ngày tải lên: 20/02/2014, 05:20

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (...

Ngày tải lên: 15/02/2014, 01:20

... nonribosomal peptide synthetases: the emerging view from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) ... Marburg, Germany Introduction Bacterial growth is strongly influenced by the availabil- ity of iron as an essential trace element employed as a cofactor [1]. The fact that the bioavailab...

Ngày tải lên: 16/02/2014, 09:20

... 1994 Value s in 2 min - mean (b) 0 5 10 15 20 25 30 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0 annual rate-TH1 annual rate-TH2 annual rate-TH3 Annual rate Station Annual rate= ... 10 20 30 40 50 60 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0 Wind speed (m/s) Station R5 - 1994 R50 - 1994 (d) 20...

Ngày tải lên: 18/02/2014, 13:20

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... specifically measures HSF1 DNA-binding activity. Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombina...

Ngày tải lên: 18/02/2014, 14:20

... 710–728 RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778 Full-length sequencing of RpCAbr RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723 RpCAbrR3 ... 706–723 RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483 Probe amplification for FISH RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAtrFp...

Ngày tải lên: 18/02/2014, 16:20