Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L ) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... et al.(Eur. J. Biochem. 26 9) Ó FEBS 2002 Characterization of a chemosensory protein (ASP3c) from honeybee ( Apis mellifera L. ) as a brood pheromone carrier Loı¨c Briand 1 , Nicharat Swasdipan 2 , ... filtration analysis showed that ASP3c is monomeric at neutral pH. Using ASA, a fluorescent fatty acid anthroyloxy analogue as a probe, ASP3c was shown...

Ngày tải lên: 21/02/2014, 03:20

11 642 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... lipids in cells from human adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 ... normal cell duplication, cell mutation or cell death. Inadequate DNA repair often results in apoptosis. Lack of functional p53 in HeLa cells fails to induce cell cycle arrest in G1. Cel...

Ngày tải lên: 18/02/2014, 13:20

14 765 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... chitinase-like protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GH, glycoside hydrolase; HC-gp39, human cartilage glycoprotein-39 (also called YKL-4 0); LPS, lipopolysaccharide; YKL-40, ... insects and mammals as non- enzymatic members of the glycoside hydrolase family 18. Recently, the first molluscan chitinase-like protein, named Crassostrea gigas (Cg)-Clp1, was shown to con...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... activit- ies of firefly and Renilla luciferase. Cell lysis and luciferase assays were performed using the Dual Luciferase Reporter Assay System (Promega). Light emission was measured by Wallac 1420 ARVOMX ... cell extract prepared from QGP-1 cells by sonication. Protein assay was carried out using a protein assay kit (Bio-Rad, Rich- mond, CA) with BSA as a standard, and 10 lg of...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI 1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... and plays a crucial role in cytoplasmic and apoplastic pH homeostasis [1,2]. The PM H + -ATPase participates in a variety of physiological processes such as phloem loading, stomata o...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... Extracellular peptidases hydrolyse large proteins into smaller peptides for absorption by the cell, whereas intracellular peptidases play a major role in regulation of metabolism [2]. The families of ... Suc-Ala-Ala- Pro-Phe-pNA (Sigma Aldrich) as substrate. The peptidase assay was carried out in a total volume of 250 lL, contain- ing 10 lL enzyme solution and 240 lL of standard...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢- CATATGCACAAAACCCACAGTAC P2O 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH 5¢- CATATGACTGGAGACTTTAAGATC P2Z 5¢-TAT GGATCCTCACCACCCAATTTCGGAAAG P2ZH ... Glutamate, glutamine and the reaction mixture were dansylated separately and aliquots (2.5 nmol each) were applied on silica gel 60 F 254 and developed in chl...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... pGL3b: Prm3aa AP)1 *, pGL3e:Prm3aa AP)1 *, pGL3b:Prm3aaa AP)1 * and pGL3e:Prm3aaa AP)1 *. Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered ... Qiagen Ltd (Crawley, UK). [ 32 P]ATP[cP] (6000 Ci Æmmol )1 at 10 mCiÆ mL )1 ) was from Valeant Pharmaceuticals (ICN; Costa Mesa, USA). All other reagents were molecular...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

... carnation petals, while lane 4 was loaded with rat liver plasma membrane vesicles. In all samples, antibodies A and B both revealed a protein band of % 38 kDa (arrow). Immunolabelling of carnation ... Igs. Subcellular fractions from carnation petals (microsomes, lane 1; plasma membranes, lane 2; tonoplast, lane 3) and rat liver plasma membranes (lane 4) were separated by SDS...

Ngày tải lên: 20/02/2014, 01:20

15 589 0
Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

... (A) Parental L cells (dotted line) and L cells transfected (dark line) with ICAM-1, ICAM-2 and ICAM-4 cDNAs were stained with mAbs anti-ICAM-1 (LB- 2), anti-ICAM-2 (B-T 1), and anti-ICAM-4 (BS4 6) ... using heparin as an anticoagulant and the LW (a – ,b – ) blood sample (ICAM-4 negative red cells) was kindly provided by Kathy Burnie (Hematology University Hospital, Ontario...

Ngày tải lên: 20/02/2014, 11:20

14 495 0
w