Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells Anthoula Gaigneaux, Jean-Marie Ruysschaert and Erik Goormaghtigh Laboratory of Structure and ... infrar ed spectroscopy for c lassification. Further analysis o f t he spectral differences indicated that discrimination between r esistant and sensitive cell...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain antibodies are most similar to ... stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of selected pha...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

... (Ci), (M,),(F,))) be a tree, and X be a set of variables. A variable assignment a : X N is a function that assigns a node from N to each variable. Let a be a variable assignment. The truth ... cate- gories as node labels, grammatical functions as edge labels and dependency relations. The syn- tactic categories follow traditional phrase struc- ture and the the...

Ngày tải lên: 22/02/2014, 02:20

8 375 0
Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

... Introduction Making use of previously translated texts is a very appealing idea that can be of considerable prac- tical and economical benefit as a translation aid. There are different ways to exploit ... Nationalization Situations where a document needs re-translation are usually associated with commercial products that undergo modifications and revisions and require ac-...

Ngày tải lên: 22/02/2014, 10:20

5 456 0
Tài liệu Báo cáo khoa học: Angiopoietin-like proteins: emerging targets for treatment of obesity and related metabolic diseases pptx

Tài liệu Báo cáo khoa học: Angiopoietin-like proteins: emerging targets for treatment of obesity and related metabolic diseases pptx

... of ANGPTL2 signaling as a therapeu- tic strategy is more beneficial. Because ANGPTL2 promotes vascular inflammation via the a5 b1 integrin ⁄ Rac1 ⁄ NF-jB pathway [15] and vascular injury accompanied ... may be a mediator linking smoking to cardiovascular disease in an autocrine or paracrine manner. Blocking ANGPTL2 signaling may also be beneficial also in preventing and treating cardi...

Ngày tải lên: 14/02/2014, 22:20

6 610 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... to lm) and stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galactosidase A variants ... S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 20 Fa...

Ngày tải lên: 18/02/2014, 16:20

7 507 0
Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx

Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx

... a- 1,3-glucanase; mycoparasitism; Trichoderma asperellum Correspondence E. Monte, Centro Hispano Luso de Investigaciones Agrarias, Universidad de Salamanca, Edificio Departamental, Plaza Doctores de la ... Trichoderma vs. Botrytis confron- tation in plate assay (2) and during Trichoderma vs. Trichoderma confrontation in plate assay (3). Mycoparasitic a- 1,3-glucanase from T. asperellum L....

Ngày tải lên: 19/02/2014, 16:20

7 552 0
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

... be false. Actions have a number of param- eters, as well as a precondition and effect, both of which are logical formulas. When a planner tries to apply an action, it will first create an action ... without being changed by the action. Atoms are printed in boldface iff they contradict the goal. This plan can be read as a derivation tree that has one node for each action insta...

Ngày tải lên: 20/02/2014, 12:20

8 339 0
Tài liệu Báo cáo khoa học: "Seeing stars: Exploiting class relationships for sentiment categorization with respect to rating scales" doc

Tài liệu Báo cáo khoa học: "Seeing stars: Exploiting class relationships for sentiment categorization with respect to rating scales" doc

... 30% Table 2: Average over authors and class pairs of between- class vocabulary overlap as the class labels of the pair grow farther apart. shows that in aggregate, the vocabularies of distant classes ... examples for one author are: “meaningless”, “disgusting” (class 0); “pleasant”, “uneven” (class 1); and “oscar”, “gem” (class 2) for the three-class case, and, in the four-class c...

Ngày tải lên: 20/02/2014, 15:20

10 511 0
w