Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

... supernatant was used for purification of the recombinant protein. Purification of the recombinant phosphohistidine phosphatase A 9-mL sample of the supernatant of the bacterial lysate was chromatographed ... phosphohistidine phosphatase and an endosomal protein may be of interest in the light of the recently described histidine phosphorylation of annexin I from...

Ngày tải lên: 21/02/2014, 01:21

8 666 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... suggest that certain enzymes, and therefore the corresponding genes of the A2 0 1A biosyn- thetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways, respectively. The ... Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A2 0 1A from...

Ngày tải lên: 21/02/2014, 01:21

9 728 0
Tài liệu Báo cáo Y học: Identification of syntaxin-1A sites of phosphorylation by casein kinase I and casein kinase II ppt

Tài liệu Báo cáo Y học: Identification of syntaxin-1A sites of phosphorylation by casein kinase I and casein kinase II ppt

... Identification of syntaxin- 1A sites of phosphorylation by casein kinase I and casein kinase II Thierry Dubois 1 , Preeti Kerai 2, *, Michele Learmonth 1 , Andy Cronshaw 1 and Alastair Aitken 1 1 The ... CKI) are s erine/threonine protein k inases widely expressed in a range of eukaryotes including yeast, mammals and plants. They have been shown to play a role in diverse phy...

Ngày tải lên: 22/02/2014, 04:20

6 403 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

... (w/w) acrylamide in the separating and stacking gels, respectively. In order to estimate the ratio between the amounts of UP12 and the total amount of protein in the extracts, a series of samples containing ... stationary phase the rate of synthesis of heat-shock proteins increases considerably, but only transiently [2,18]. Similarly, we observed that the stead...

Ngày tải lên: 22/02/2014, 07:20

9 548 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... Arg-Gly-Gly sites and RGG con- taining Arg methylated by protein arginine N-methyltransferase 3 decrease the binding ability of EWS to G-quadruplex DNA and RNA. These find- ings suggest that the ... nucleic acid-binding proper- ties of EWS remain poorly characterized. EWS belongs to a family that includes the closely related proteins translocated in liposarcoma and the TATA-bin...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR Zftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCR Zf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACE Zf3¢ tbet-F2 ... STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipper domain and fork-head domain of...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... identified in M. catarrhalis. The acyloxyacyl-linked secondary acyl chains of the lipid A moiety of the LOS are important in some biological activities of M. catarrhalis. Elucidation of lipid A ⁄ LOS biosynthesis, ... AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) This study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [...

Ngày tải lên: 18/02/2014, 14:20

14 675 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... of the TGF b–activin pathway include Smad2 and Smad3. The R-Smads of the BMP pathway include Smads 1, 5 and 8. The type I receptor phos- phorylates the R-Smad at its C-terminal MH2 domain, causing ... DeMarco R, Martins EA, Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP, Nishiyama MY Jr, Kitajima JP, Adamson RE et al. (2003) Transcriptome analysis of the acoelomate human para...

Ngày tải lên: 18/02/2014, 16:20

19 655 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... reticulum area around the nucleus and is maxi- mal in the cytoplasmic apex of the branchial epidermis. By contrast, the staining is very weak basally along the myoepithelium that lines the internal ... zinc-containing enzymes catalyzing the reversible hydration of CO 2 to bicarbonate. Ubiqui- tous in a wide range of eukaryotic organisms, they are also widespread in...

Ngày tải lên: 18/02/2014, 16:20

14 591 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... GTTCTTGTTCCTGCTCATCAGTATG TGGATCGCCAAAAACTCATG QM protein AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA HSP70 TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 1 2A ... CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT HSP23 CGTCCGATTTCTTCTCGTGTTT ACCAGAAGACATTACAGTGAAAATTGA Chaperonin-containing TCP1, subunit 7, isoform b, isof...

Ngày tải lên: 18/02/2014, 16:20

11 571 0
w