Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf
... supernatant was used for purification of the recombinant protein.Purification of the recombinant phosphohistidinephosphatase A 9-mL sample of the supernatant of the bacterial lysatewas chromatographed ... phosphohistidine phosphatase and anendosomal protein may be of interest in the light of the recently described histidine phosphorylation of annexin I from a membrane preparation of ovine tracheal epithelia[34]. ... Protein kinases and phosphatases that acton histidine, lysine, or arginine residues in eukaryotic proteins: a possible regulator of the mitogen-activated protein kinase cascade.Pharmacol. Ther....
- 8
- 666
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... suggest that certain enzymes, andtherefore the corresponding genes of the A2 0 1A biosyn-thetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways,respectively. The ... Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A2 0 1A from Streptomyces capreolus Irene Saugar*, Eloı´sa Sanz*, Miguel A ´ngel ... purcluster of S. alboniger [6]. They were accordingly namedataP3, ataP5, ataP4, ataP10 and ataP7. The two additionalones were named ata12 and ataPKS1 (Figs 2 and 3). Allshared a codon usage and a G+C...
- 9
- 728
- 0
Tài liệu Báo cáo Y học: Identification of syntaxin-1A sites of phosphorylation by casein kinase I and casein kinase II ppt
... Identification of syntaxin- 1A sites of phosphorylationby casein kinase I and casein kinase IIThierry Dubois1, Preeti Kerai2,*, Michele Learmonth1, Andy Cronshaw1and Alastair Aitken11 The ... CKI) are s erine/threonine protein k inaseswidely expressed in a range of eukaryotes including yeast,mammals and plants. They have been shown to play a role in diverse physiological events including ... METHODSMaterials[c-32P]ATP was from Amersham. Casein and histone H1were purchased from Sigma. Recombinant c asein kinase IIand the catalytic subunit o f protein kinase A ( PKA) were from Calbiochem-Novabiochem. The...
- 6
- 403
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... (w/w) acrylamide in the separating and stacking gels, respectively. In order toestimate the ratio between the amounts of UP12 and the total amount of protein in the extracts, a series of samplescontaining ... stationary phase the rate of synthesis of heat-shock proteins increases considerably,but only transiently [2,18]. Similarly, we observed that the steady-state amount of GroEL remains constant ... shown that GatY aggregates at 42 °Cinmutantcells containing a deletion for DnaK [35]. Taken together,these observations indicate that maintenance of the correctfolding state of GatY in E. coli...
- 9
- 548
- 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... Arg-Gly-Gly sites and RGG con-taining Arg methylated by protein arginine N-methyltransferase 3 decrease the binding ability of EWS to G-quadruplex DNA and RNA. These find-ings suggest that the ... nucleic acid-binding proper-ties of EWS remain poorly characterized. EWS belongsto a family that includes the closely related proteinstranslocated in liposarcoma and the TATA-bindingprotein-associated ... probes are indicated above each lane. The DNA–protein complexes were resolved by 6% PAGE and visu-alized by autoradiography.K. Takahama et al. Identification of Ewing’s sarcoma proteinFEBS Journal...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 ... STAT protein all-alpha domain, STATprotein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipperdomain and fork-head domain of foxp3. In addition,for stat6 and ... Immu-nity 12, 27–37.14 Yamashita M, Ukai-Tadenuma M, Miyamoto T,Sugaya K, Hosokawa H, Hasegawa A, Kimura M,Taniguchi M, DeGregori J & Nakayama T (2004)Essential role of GATA3 for the maintenance...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc
... identified in M. catarrhalis. The acyloxyacyl-linked secondary acyl chains of the lipid A moiety of the LOS are important in some biologicalactivities of M. catarrhalis. Elucidation of lipid A ⁄ LOS biosynthesis, ... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... two genes, particu-larly lpxX, encoding late acyltransferases responsible for incorporation of the acyloxyacyl-linked secondary acyl chains into lipid A, are importantfor the biological activities...
- 14
- 674
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... of the TGF b–activin pathway include Smad2and Smad3. The R-Smads of the BMP pathwayinclude Smads 1, 5 and 8. The type I receptor phos-phorylates the R-Smad at its C-terminal MH2 domain,causing ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al.(2003) Transcriptome analysis of the acoelomate humanparasite Schistosoma ... onLacZ filter-lift assay in less than 1 day, and > 7.5 b-gal units in liquid LacZ assay). AD, Gal4 activation domain; BD, Gal4 binding domain.Yeast two-hybrid Yeast three-hybridSmSmad4-BD SmTbRI-BD...
- 19
- 653
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... reticulum area around the nucleus and is maxi-mal in the cytoplasmic apex of the branchial epidermis.By contrast, the staining is very weak basally along the myoepithelium that lines the internal ... zinc-containing enzymes catalyzing the reversible hydration of CO2to bicarbonate. Ubiqui-tous in a wide range of eukaryotic organisms, they arealso widespread in the Archaea and Bacteria ... protein sequences. Iden-tical and similar amino acids shared by at least 50% of the isoforms are shown in black and grey, respectively. Histidine residues involved in zinc binding in the catalytic...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A ... CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor ... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAARas family GTP-binding protein Rho1p GATACAGCAAACGGAAAGTCAACACAGTTCCTCGGGCCAACACystatin B GCCCCCCTCCCACACACATCTTCGGCCGTCTTTCCCTSL GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM...
- 11
- 570
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctai lieu bao cao thuc tap y si da khoatai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo y họctài liệu báo cáotài liệu báo cáo môn triếttài liệu báo cáo tài chínhtài liệu di truyền y họctài liệu báo cáo mônbáo cáo y họctài liệu báo cáo tài chính vốn bằng tiền tai doanh nghiệptài liệu vi sinh y họctài liệu báo cáo môn triếtquan hệ sản xuấtBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP