Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato Sandra Westphal 1 , Daniel Kolarich 2 , Kay Foetisch 1 , Iris Lauer 1 , Friedrich Altmann 2 , ... biological activity of allergens. Keywords: Lyc e 2; tomato; food allergen; IgE reactivity; glycoprotein. To date, only few attempts have been...

Ngày tải lên: 21/02/2014, 00:20

... until all free water was evaporated. After this, IR spectra were recorded at room temperature and at 37 °C. Usually, the original spectra were evaluated directly and a spectral analysis was performed ... analysis [23 ] were performed. 327 2 K. Brandenburg et al. (Eur. J. Biochem. 27 0) Ó FEBS 20 03 Aggregate structures and molecular shape For the determination of the three-dime...

Ngày tải lên: 21/02/2014, 00:20

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... Quik- Change Site-Directed Mutagenesis Kit (Strategene). The primers used were: 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACA...

Ngày tải lên: 18/02/2014, 06:20

... 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA- CATGG-3¢ were used for detecting ... that for actin mRNA. Values were calculated as a percentage of the highest value obtained during maturation. Data represent the mean ± standard deviation of four exp...

Ngày tải lên: 18/02/2014, 11:20

... polymerase activity on metal ions. The results are the means of three independent experiments. (C) The dependence of polymerase activity on the temperature was determined by assaying the enzyme ... as described in Experimental procedures. Reaction products were separated on 20 % polyacrylamide ⁄ urea gels and radioactivity was detected by autoradiography. Lanes 1–4 of each gel we...

Ngày tải lên: 18/02/2014, 18:20

... between helices H1 and H2, and 84 residues instead of 10 resi- dues between helices H2 and H3 (Fig. 2) . Molecular characterization of zebrafish PrP1 The imperfect match obtained on Ensembl zebrafish gene GENSCAN00000038006 ... p.babin@gpp.u-bordeaux1.fr Note The sequence data presented here have been deposited with the GenBank ⁄ EMBL Data Libraries under the accession numbers AJ...

Ngày tải lên: 19/02/2014, 16:20

... clinical setting, because the overuse and misuse of antibacterial agents have resul- ted in the emergence of antibiotic-resistant strains [5]. Therefore, the alarming rise of antibiotics resistance among ... 2- ( {2- [ (2- { [2- (2, 3-dimethylanilino) -2- oxoethyl]sulfanyl}-1,3-benzo- thiazol-6-yl)amino] -2- oxoethyl}sulfanyl)-N- (2- naphthyl) acetamide (4) and maesaquinone diacet...

Ngày tải lên: 19/02/2014, 05:20

... the defense of pathogens, isolation and characterization of cytokines is of prime importance. Only a few cytokines and chemokines are known in fish, where they have been cloned either by expressed sequence ... forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 TTGCTGATCCACATCTGCTG T7- forward TAATACGACTCACTATAGGG SP6-reverse ATTTAGGTGACACTATAGAA Fig. 1. Genomic sequence structure of...

Ngày tải lên: 20/02/2014, 02:21

... 6-well plates for reading in a microplate fluorescence analyzer. Values are showed in the percentage i nhibition of peptide-treated cells and expressed as the mean of three independent experiments. 28 78 ... five or more SRBCs bound were counted as rosettes. At least 20 0 cells were counted to determine the percentage of E- rosette cells. Values are percentage inhibition of pepti...

Ngày tải lên: 19/02/2014, 13:20

... obtained was corrected by manual inspection, and unambiguously aligned 1 82 sites were selected and used for phylogenetic analysis. Data files for the original alignment and selected sites are available from ... the enteric protozoan parasite Entamoeba histolytica was characterized. The E. histolytica PGDH gene (EhPGDH) encodes a protein of 29 9 amino acids with a calculated mo...

Ngày tải lên: 19/02/2014, 13:20